Urbanus ( Urbanus ) cubanus, Zhang & Cong & Shen & Song & Grishin, 2023
|
publication ID |
4594F1CA-9EE8-4A80-A0CA-792676139D20 |
|
publication LSID |
lsid:zoobank.org:pub:4594F1CA-9EE8-4A80-A0CA-792676139D20 |
|
persistent identifier |
https://treatment.plazi.org/id/D20187A3-0253-8C00-FE54-FE44FA3DFF29 |
|
treatment provided by |
Felipe |
|
scientific name |
Urbanus ( Urbanus ) cubanus |
| status |
new species |
Urbanus ( Urbanus) cubanus Grishin, new species
http://zoobank.org/ E1311827-75D9-4699-8E88-D7A317D9792A ( Figs. 29 part, 30, 31a–e)
Definition and diagnosis. The nuclear genome tree reveals a prominent clade of two specimens from Cuba ( Fig. 29 red) initially identified as Urbanus proteus domingo (Scudder, 1872) ( type locality in
Haiti) that is sister to all other Urbanus proteus (Linnaeus, 1758) ( type locality in America) we sequenced ( Fig. 29 blue branches), and is placed approximately halfway between U. proteus and its sister species Urbanus velinus (Plötz, 1881) ( type locality in Brazil: Bahia) ( Fig. 29 green). The two specimens are strongly differentiated genetically from U. p. domingo ( Fig. 29 violet, orange, and magenta labels), including two other specimens from Cuba (southeastern region) ( Fig. 29 magenta labels): Fst / Gmin /COI barcode difference of 0.51/0.00/0.8% (5 bp, barcodes are similar between the two species). Therefore, these two specimens represent a species distinct from U. proteus . This new species keys to C.13.1(b) in Evans (1952) and differs from its closest relative U. proteus in broader and straighter ventral hindwing dark brown bands and a darker area by mid-costa, hyaline spot in forewing cell CuA 1 -CuA 2 closer aligned with the spot in discal cell rather than shifted distad, absent or small submarginal hyaline spots in forewing cells M 1 -M 2 and M 2 -M 3, and narrower antrum ( Fig. 31 blue arrows). Due to unexplored phenotypic variation, definitive identification is provided by DNA, and a combination of the following characters is diagnostic in the nuclear genome: aly103.33.9:A90G, aly103.33.9:T160C, aly103.33.9:G162C, aly207.9.6: A180G, aly103.50.3:T60C and in COI barcode: C220C, T322C, T385C, T610C, C616T.
Barcode sequence of the holotype. Sample NVG-18057F12, GenBank OR837732, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCAGGATTAATTGGAACTTCTTTAAGATTACTTATTCGAACTGAATTAGGAACCCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATTGTAACAGCTCATGCTTTCATTATAATTTTCTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGACTAGTTCCATTAATAATAGGTGCCCCTGATATAGCTTTCCCCCGTA TAAATAATATAAGATTTTGATTATTACCCCCTTCTTTAACTTTATTAATTTCAAGAAGAATTGTTGAAAATGGTGCTGGTACCGGATGAACAGTCTATCCCCCTCTTTCATCTAATATTGC CCACCAAGGAGCTTCCGTTGACCTAGCAATTTTTTCTCTTCATCTTGCTGGAATTTCATCAATTCTTGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAATAATTTATCT TTTGATCAAATACCTTTATTTGTTTGAGCTGTAGGAATTACAGCATTATTATTATTACTCTCTTTACCTGTATTAGCAGGAGCTATTACTATATTATTAACTGATCGAAATTTAAATACTT CATTCTTTGATCCTGCTGGAGGAGGAGATCCAATTTTATATCAACATTTATTT
Type material. Holotype: ♀ deposited in the Zoologische Staatssammlung München, Germany [ ZSMC], illustrated in Fig. 30a, bears six labels: four white, the 3 rd greenish [ CUBA, La Habana, | Boyeros, Finca La | Chata ( 23.036 N, - | 82.376 W), July 9 2014 | R. Núñez leg.], [RNA-1-171], [BC ZSM Lep 92903], [DNA sample ID: | NVG-18057F12 | c/o Nick V. Grishin ], [DNA sample ID: | NVG-23012A03 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♀ | Urbanus (Urbanus) | cubanus Grishin]. The first NVG number corresponds to a sampled leg, and the second is for the abdomen DNA extraction followed by genitalia dissection. Paratype: 1♀ Cuba, Gundlach leg., Coll. Thieme, genitalia vial NVG-22111G12 (NVG-21126H02, GenBank barcode OR837733, Fig. 30b) [ MFNB].
Type locality. Cuba: Havana, Boyeros, Finca La Chata , GPS 23.036, −82.376 GoogleMaps .
Etymology. The name is given for the country of the type locality. The name is a masculine adjective.
Distribution. Cuba; currently confirmed from the northwestern region ( Havana).
reddish-brown, Fig. 30) is due to fading with age: the paratype was collected more than a century ago.
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
|
Kingdom |
|
|
Phylum |
|
|
Class |
|
|
Order |
|
|
Family |
|
|
Genus |
