Terebellides shetlandica Parapar, Moreira & O'Reilly , 2016

Barroso, Maria, Moreira, Juan, Capa, Maria, Nygren, Arne & Parapar, Julio, 2022, A further step towards the characterisation of Terebellides (Annelida, Trichobranchidae) diversity in the Northeast Atlantic, with the description of a new species, ZooKeys 1132, pp. 85-126 : 85

publication ID	https://dx.doi.org/10.3897/zookeys.1132.91244
publication LSID	lsid:zoobank.org:pub:4168C32E-37A7-4912-A909-4912E69030AA
persistent identifier	https://treatment.plazi.org/id/37ADFC8C-713C-5C8A-8645-BBC870D0A3D4
treatment provided by	ZooKeys by Pensoft
scientific name	Terebellides shetlandica Parapar, Moreira & O'Reilly , 2016
status

Treatment

Terebellides shetlandica Parapar, Moreira & O'Reilly, 2016 View in CoL

Figs 2A, B View Figure 2 , 3A View Figure 3 , 4A View Figure 4 , 5 View Figure 5 , 9 View Figure 9 , 10A View Figure 10 , 11 View Figure 11 , 12 View Figure 12

Terebellides shetlandica Parapar, Moreira & O’Reilly, 2016a: 211-225, figs 1-9, 11.

Terebellides shetlandica Species 1 - Nygren et al. 2018: 18-22, figs 6, 10.

Material examined.

30 specimens (Suppl. material 1), Skagerrak ( GNM14640 View Materials ); Swedish coast (ZMBN116171, ZMBN116181, ZMBN116185, ZMBN116186, ZMBN116187, ZMBN116188, ZMBN116191, ZMBN116192, ZMBN116193, ZMBN116196, ZMBN116198, ZMBN116200, ZMBN116201, ZMBN116202, ZMBN116203, ZMBN116204, ZMBN116206); Norwegian coast (ZMBN116207, ZMBN116208, ZMBN116214, ZMBN116216, ZMBN116219, ZMBN116220, ZMBN116221, ZMBN116226, ZMBN116227, ZMBN116228, ZMBN116235, ZMBN116242) .

GenBank accession numbers of material examined (COI).

MG024894, MG024895, MG024896, MG024897, MG024898, MG024899, MG024900, MG024901, MG024902, MG024903, MG024904, MG024905, MG024906, MG024907, MG024908, MG024909, MG024910, MG024911, MG024912, MG024913, MG024914, MG024915, MG024916, MG024917, MG024918, MG024919, MG024920, MG024921, MG024922, MG024923, MG024924, MG024925, MG024926, MG024927, MG024928, MG024929, MG024930, MG024931, MG024932, MG024933, MG024934, MG024935, MG024936, MG024937, MG024938, MG024939, MG024940, MG024941, MG024942, MG024943, MG024944, MG024945, MG024946, MG024947, MG024948, MG024949, MG024950, MG024951, MG024952, MG024953, MG024954, MG024955, MG024956 .

Diagnostic features of studied material.

Complete individuals ranging from 5.0-16.0 mm in length (Fig. 9 View Figure 9 ). Branchial dorsal lobes lamellae provided with well-developed papillary projections and branchial ventral lobes provided with long filaments, ranging from 175.0-225.0 µm in length (Figs 2A, B View Figure 2 , 4A View Figure 4 , 5A, B View Figure 5 ). Between 22-26 lamellae on dorsal lobes (Fig. 5A, B View Figure 5 ). Lateral lappets present on TC 1-4; dorsal projections of thoracic notopodia on TC 2 and TC 3 (Fig. 5B View Figure 5 ). Geniculate chaetae in TC 5, acutely bent, with poorly marked capitium (Fig. 5C View Figure 5 ). Ciliated papilla dorsal to thoracic notopodia not observed. From TC 7, neuropodia with one row of type 4 thoracic uncini per torus, with rostrum/capitium length ratio of ~ 2:1 and capitium with a first row of small teeth, followed by several smaller teeth (Fig. 5D View Figure 5 ). Abdomen with 25-34 pairs of neuropodia with type 2 uncini (Fig. 5E, F View Figure 5 ). Copepods attached to body surface in three specimens (Fig. 5B View Figure 5 ).

Colour pattern.

MG staining pattern characterised by compact green colourant in SG 1-6, then turning into striped pattern in SG 7-14 and fading in following segments (Fig. 12 View Figure 12 ). Similar to pattern 1.

Nucleotide diagnostic features.

All sequences of Terebellides shetlandica share and are distinguished from other available Terebellides sequences in unique combinations of nucleotides (underlined) at the given position of our alignment: 78-98: CCAACCCGGAGCCTATTTAGGT, 186-192: CGGAAAC, 210-219: GCTAGGCGCC, 228-234: GGCATTC, 264-276: TCTCCCGCCTGCC, 288- 292: CGTT, 306: C, 333-342: CGTCTACCCT, 351-369: AGACAATATGGCACACGCC, 381-402: AGATCTGGCTATTTTCTCCCTA, 453-459: AGTAATA, 511-522: TCAGCTATAATC, 535-558: TTACTTCTTTCTCTGCCAGTTCTG.

Type locality.

NW Hutton Oilfield, between Shetland Islands and Norway, 61°10'N, 01°12'E ( Parapar et al. 2016a).

Distribution and bathymetry.

Norwegian coast and shelf, North Sea, Skagerrak, Kattegat; 25-375 m deep; 92.7% of specimens present at depths below 200 m (Figs 10A View Figure 10 , 11 View Figure 11 , Suppl. material 1).

Remarks.

Terebellides shetlandica is a small species, reaching up to 16 mm length and is characterised by having branchiae of type 3 and long filaments in ventral branchial lobes, thoracic uncini of type 4, abdominal uncini of type 2 and lacking papillae on margins of branchial lamellae (Table 1 View Table 1 ). Parapar et al. (2016a) pointed out that T. atlantis is the most similar species to T. shetlandica ; this is confirmed here according to molecular analyses and morphological examination. Both species are small sized (length: T. shetlandica , 5-16 mm; T. atlantis , 10-16 mm) and have branchiae of type 3, with free branchial lobes. However, the branchiae of T. shetlandica have a high number (22-26) of tightly packed branchial lamellae, all lobes are similar in shape and length and ventral ones bear long filaments whereas T. atlantis has a fewer number of branchiae (10-11), lamellae are not packed, lobes differ in shape and size and ventral lobes bear shorter filaments. Furthermore, the range of abdominal chaetigers number is higher in T. shetlandica than in T. atlantis (25-34 vs. 23-28 respectively).