Semalea malawi

Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina & Grishin, Nick V., 2023, Genomic analysis reveals new species and subspecies of butterflies, The Taxonomic Report of the International Lepidoptera Survey 11 (6), pp. 1-63 : 37-40

Semalea malawi Grishin, 2023 is confirmed as a species-level taxon

Genomic sequencing of Hesperiidae from the CAS collection revealed a second confirmed specimen of Semalea malawi Grishin, 2023 (type locality in Malawi, holotype sequenced as NVG-19043B12), which is also a male as the holotype but was collected in northeastern Tanzania ( Tanga District, Usambara Mts., Amani Malaria Station, elevation 300 ft, 6-Jan-1970, M. E. Irwin & E. S. Ross leg., NVG-22108B02, CASENT 8568645) ( Figs. 38b, 39). Compared to the holotype ( Fig. 38a), it is yellower in the hue of paler scales (forewing patch, ventral overscaling, palpi, and cheeks), with a slightly shorter forewing orange patch, and has a small orange subapical spot on the forewing, more expressed on the ventral side ( Fig. 39b). The COI barcode sequence of this specimen (GenBank OR837735) matches all 7 diagnostic characters given in the original description (Zhang et al. 2023b) but differs by 5 bp from the holotype. With this additional specimen, we carried out Fst / Gmin test to obtain the values 0.34/0.000 (with S. vibius (Hewitson, 1878)) and 0.55/0.000 (with S. rega (Mabille, 1889)) confirming S. malawi as a species.

http://zoobank.org/ E1AE8324-1FFE-4A14-916D-8BCC85B96105

( Figs. 40 part, 41)

Definition and diagnosis. Genomic sequencing of specimens from the southwesternmost population of Limochores mystic (W. H. Edwards, 1863) ( type locality in USA: NY, Greene Co., Huner) reveals that they are sister to all other subspecies of L. mystic in the tree inferred from the nuclear genome (autosomes only) ( Fig. 40a), although they fall among other L. mystic populations in the Z chromosome (not shown) and mitogenome trees ( Fig. 40b), and their COI barcodes differ only due to variation. Therefore, this population is likely conspecific with L. mystic ; however, being most divergent from all others, it represents a separate and new subspecies. In its duller look with more diffuse boundaries between brown ground color and yellow-orange spots, this subspecies is most similar to Limochores mystic dacotah (W. characters. Males have reduced orange scaling, spots and bands are narrower, e.g., the orange on the dorsal hindwing is reduced to a band approximately the same width as the brown margin, and the band is separated from the orange discal cell by a brownish belt. Both sexes have darker ventral sides of wings. Due to extensive phenotypic variation, definitive identification is provided by DNA, and a combination of the following characters is diagnostic in the nuclear genome: aly499.49.4:G66C, aly848.2.19:T51C, aly838. 7.2:C48T, aly838.7.2:T63C, aly1838.42.3:C34T.

Barcode sequence of the holotype. Sample NVG-22102C07, GenBank OR837736, 658 base pairs: AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATATTAGGAACTTCTTTAAGTTTATTAATTCGAACAGAATTAGGTAACCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTACCATTAATACTAGGAGCTCCTGATATAGCTTTCCCTCGAA TAAATAATATAAGATTTTGAATATTACCACCTTCACTAACATTGTTAATTTCAAGAAGAATTGTAGAGAATGGTGCAGGAACAGGTTGAACAGTTTACCCACCTTTATCTTCTAATATTGC ACATCAAGGATCTTCTGTTGATTTAGCAATTTTTTCTCTTCATTTAGCCGGAATTTCTTCTATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAAAAATTTATCA TTTGATCAAATACCTTTATTTGTATGATCTGTAGGAATTACAGCTTTATTATTACTTTTATCTTTACCTGTATTAGCAGGAGCTATTACTATATTACTTACAGATCGAAATTTAAATACTT CATTTTTTGACCCAGCAGGAGGAGGAGATCCAATTTTATACCAACATTTATTT

Type material. Holotype: ♂ deposited the California Academy of Sciences, San Francisco, CA, USA [ CAS], illustrated in Fig. 41a, bears seven printed (text in italics handwritten) labels: six white [Circle Bar Draw at | Tillman Ranch, 7100' | Coconino Co. AZ], [ 9 June 19 88 | collected by Kilian Roever], [COLLECTION OF | C. D. MacNeill], [ Polites mystic | ssp. nov. | Det.C.D.MacNeill '98], [DNA sample ID: | NVG-22102C07 | c/o Nick V. Grishin ], [{QR Code} CASENT | 8566979], and one red [ HOLOTYPE ♂ | Limochores mystic | nino Grishin ]. Paratype: 1♀ same data as the holotype (NVG-22102C08, CASENT 8566980, Fig. 41b) [ CAS].

Type locality. USA: Arizona, Coconino Co., Circle Bar Draw at Tillman Ranch , 7100 '.

Etymology. The name is formed from the name of the county of the type locality [Coco] nino and is a noun in apposition.

Distribution. Only known from central Arizona, USA. Populations in southwestern Colorado should be studied to determine their taxonomic identity.