Phyllodonta esperanza Sullivan

Sullivan, J. Bolling, 2014, The Phyllodonta latrata (Guenee) species group in Costa Rica (Geometridae, Ennominae), ZooKeys 421, pp. 3-19 : 5-7

Taxon classification Animalia Lepidoptera Geometridae

Phyllodonta esperanza Sullivan sp. n. Figs 1-5, 16

Type material.

Holotype male: Costa Rica, Tapanti Parque (9.456°N, 83.417°W), Cartago Province, 1275 m, 7-9 July 2008, J. Bolling Sullivan (DNA voucher #11-CRBS-381) (INBio). Paratypes: 5♂, 4♀: 1♂, same data as holotype (DNA voucher #11-CRBS-288); 1♂, same data as holotype but 12-17 February 2005 (07-CRBS-1206), (dissection #JBS-3305); 1♂, Costa Rica, Parque National Volcan Poas (10.103°N, 84.342°W), Alajuela Province, 2500 m, 7-8 August 2007, J. Bolling Sullivan (07-CRBS-359), (dissection #JBS-2006); 2♀, same data (07-CRBS-357), (JBS-2007); 3♂, Costa Rica, Villa Mills (9.334°N, 83.423°W), Cartago Province, 2845 m, J. Bolling Sullivan (10-CRBS-764, 767, 1531), 2♀, same data (10-CRBS-765, 766). BMNH, INBio, JBS, USNM.

Etymology.

The species is named for the biological station La Esperanza in the Talamanca Mountains, Cartago, Costa Rica, where many of the specimens were taken.

Diagnosis.

Maculation does not seem to be diagnostic for distinguishing this species. It is best characterized by barcode data and the genitalia. It has the highest altitude distribution but does overlap that of Phyllodonta intermediata below 2300 m. In the male, the base of the socius is usually swollen (straight in the other two species); the vesica is unarmed with pouches emanating from the left side (right side in Phyllodonta intermediata , armed in Phyllodonta alajuela ). In the female, the collar on the ductus bursae is narrow and the signum on the corpus bursae is crescent shaped, often with a medial kink and with the anterior and posterior sides narrowly separated. In the other two species the collar is wider and the signa are more oval shaped, never kinked.

Description.

Male. (Fig. 1) Head -labial palps warm brown, slightly porrect. First segment upcurved, second segment similar in length and tufted slightly over third segment, which is 1/3 as long and angled ventrally. Haustellum developed. Eyes hemispherical, large, ocellus present. Frons brown, slightly pointed with scaling directed anteriorly. Scape cream proximally, brown laterally and distally. Cream color extends along dorsal edge of antenna to tip. Antennal segments oblong with minute setae at base of each segment. Interantennal area warm brown, lighter onto collar. Thorax and Abdomen–Vertex brown, fine scaling extending onto thorax, most scales expanding to three pointed tip, a few black-tipped. Tegulae brown, abdomen with closely appressed scaling, gray brown dorsally, warm brown ventrally. Legs finely scaled, warm brown, tibia on first two legs with 3 evenly spaced white spots dorsally, proximal smallest, distal largest, tarsal spines prominent (0-2-4). Wings–forewings warm brown with prominent antemedial and postmedial lines that undulate, in both cases forming two outward bulges. Antemedial bulges separated by prominent cleft. Both lines black edged with lighter grayish scales proximally. Black scaling distal to reniform at costa and forming a diffuse line paralleling antemedial line. Reniform spot small, black and forming center of a gray circle. Forewings long, outer margin truncated at costa with a distinct notch medially, forewing length 23.0 mm (20-26 mm, n=18). Hindwing with prominent postmedial line, margin with submedial notch. Underside of wings warm brown, forewing with postmedial line prominent, medial line visible, antemedial line absent. White blotch subterminal at notch, larger black blotch proximal to it. Small discal spot present. Hindwing underside with prominent postmedial line, prominent discal spot, small yellow line of scales distal to postmedial line on both wings. Cream streak from wing base widening to anal angle. Male Genitalia (Figs 3, 5) (20 dissections) - uncus unsclerotized, short with terminal setae. Socius triangular shaped at base and curving distally toward tip. Well-defined tegumen with triangular gnathos, rounded at tip with small setae. Juxta narrow basally, forming a pocket and widening toward transitilla lobes that widen medially. Costa well sclerotized, tapering to tip of valva. Valva broad with two ridges bearing setae. Subcostal ridge tapers slightly and meets a broader submarginal ridge that broadens to half width at valve tip. Saccus V-shaped and rounded slightly at basal point. Aedeagus partially sclerotized distally, a band of striations at tip. Ductus inserts sub-basally. Vesica sac-like, curving ventrally; two outpockets medially, most prominent one bifurcated and curving to left with smaller lobe to right. No cornuti or sclerotized areas. Vesica slightly longer than aedeagus. Female. (Fig. 2) - similar to male but larger, gray-brown ground color, cross lines usually more prominent, forewing length 26.1 mm (25-27 mm, n=7). Gray circle around reniform more distinct. Undersides similar to male but gray brown. Female Genitalia (Figs 4, 16) (8 dissections) -Anal papillae with setae, distally truncated in shape with anterior apophyses shorter than posterior apophyses. Anal plate not sclerotized, forming a broad funnel. Ductus bursae moderately short with sclerotized collar at posterior end. Collar ends form obvious abutment. Accessory bursae striated, widening significantly prior to midpoint and striations continuing onto corpus bursae. Corpus bursae 2 × as wide as ductus bursae, mostly unstriated with crescent-shaped signum. Signum varies but usually an elongate crescent often kinked medially and with several rows of broad basal spines on anterior side of crescent.

Barcodes.

Twenty nine specimens have been barcoded and exhibit twelve haplotypes that differ from each other by a maximum of 0.8%. They differ from those of Phyllodonta intermediata by a minimum of 4.6% and from Phyllodonta alajuela by a minimum of 4.8%. The most common haplotype (10-CRBS-762) is:

AACATTATATTTTATTTTTGGGATTTGAGCTGGAATAGTAGGAACATCTTTAAGTTTATTAATTCGAGCTGAATTAGGAAATCCTGGATCTCTAATTGGAGATGATCAAATTTATAATACTATTGTAACTGCTCATGCTTTTATTATAATTTTCTTTATAGTAATACCTATTATAATCGGAGGATTTGGAAATTGATTAGTTCCTTTAATATTAGGAGCTCCTGATATGGCTTTCCCTCGAATAAATAATATAAGATTTTGATTACTTCCACCTTCTATTACATTATTAATTTCTAGAAGAATTGTGGAAAATGGAGCTGGGACAG GATGAACTGTTTATCCTCCTTTATCTTCTAATATTGCTCACGGTGGTAGTTCTGTTGACCTTGCTATTTTTTCATTACATTTAGCTGGTATTTCATCAATTTTAGGGGCTATTAATTTTATTACTACAATTATTAATATACGATTAAATAATTTATCTTTTGATCAAATACCTTTATTTGTATGAGCAGTAGGAATTACTGCATTTTTATTATTATTATCATTACCTGTTTTAGCTGGAGCTATTACTATATTATTAACAGATCGAAATTTAAATACATCTTTTTTTGATCCTGCTGGAGGAGGAGATCCAATTTTATACCAACATTTATTT

Distribution.

Known from above 1200 m in the Talamancas as well as the Central Volcanic and Tilaran ranges in Costa Rica. In flight throughout the year.

Remarks.

Nothing is known about the biology of this species. Its range probably extends into the other mountain ranges in Costa Rican and perhaps in northern Panama.