Ithomiola ( Ithomiola ) perutanos, Zhang & Cong & Shen & Song & Grishin, 2024
|
publication ID |
2B44E674-0784-4977-ADE5-A8AD69E30582 |
|
publication LSID |
lsid:zoobank.org:pub:2B44E674-0784-4977-ADE5-A8AD69E30582 |
|
persistent identifier |
https://treatment.plazi.org/id/C45B002E-FFE3-FF83-E196-A943747235C4 |
|
treatment provided by |
Felipe |
|
scientific name |
Ithomiola ( Ithomiola ) perutanos |
| status |
new species |
Ithomiola ( Ithomiola) perutanos Grishin, new species
http://zoobank.org/ 69184170-F545-4A05-9FEC-6A440A3747B0 ( Figs. 9 part, 10c)
Definition and diagnosis. Genome-based phylogeny of Ithomiola ( Ithomiola) C. Felder & R. Felder, 1865 (type species Ithomiola floralis C. Felder & R. Felder, 1865 ) reveals that a specimen from Cuzco, Peru ( Fig. 9 orange) identified as Ithomiola bajotanos J. Hall, 2005 (type locality in Ecuador: Tungurahua) ( Fig. 9 green) due to phenotypic similarities is genetically differentiated from it at the species level ( Fig. 9), e.g., its COI barcode differs by 2.1% (14 bp) from I. bajotanos paratype from Colombia, and therefore represents a new species. This species is most similar to its closest relative, I. bajotanos , in size and less developed blue spots in the basal area of the dorsal forewing, and differs from it by smaller white spots in the ventral hindwing discal area in cells Sc+R 1 -Rs and Rs-M 1. These spots are larger than in a typical Ithomiola tanos (Stichel, 1910) (type locality in Bolivia, holotype sequenced as NVG-18078C09). Furthermore, forewing spots are, on average, smaller, and darker brown areas basad of spots on the ventral side are longer. Because phenotypic variation of this species has not been explored, definitive identification is provided by DNA, and a combination of the following characters is diagnostic in the nuclear genome: cne7381.3.1:A60G, cne5239.2.2:T39C, cne5239.2.2:A129C, cne10306.1.1:C858T, cne7597.1.2:T96C, cne3123.5.1:T249T (not C), cne8031.2.1:C384C (not A), cne8031.2.1:T390T (not A), cne224.6.2:T48T (not A), cne123.8.6:C521C (not T) and in COI barcode: A46T, T124C, T205C, T265C, A474G, T499C, 508G.
Barcode sequence of the holotype: Sample NVG-19038C05, GenBank PP254248, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAATCGGAACTTCTTTAAGTTTATTAATTCGAATAGAATTAGGTACTCCAGGATCTTTAATTGGTGATGATCAAATTTATAACACT ATCGTTACAGCTCATGCTTTTATTATAATTTTCTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGACTTGTTCCCTTAATATTAGGAGCTCCAGATATAGCTTTCCCTCGTA TAAATAATATAAGATTTTGACTCCTTCCCCCTTCATTATTTCTTCTTATTTCAAGAAGAATTGTTGAAAATGGAGCAGGTACTGGATGAACTGTATATCCTCCTTTATCTTCTAATATTGC CCATGGAGGATCTTCTGTTGATTTAGCAATTTTCTCTTTACATTTAGCAGGTATTTCATCAATTTTAGGAGCTATTAATTTTATTACTACTATTATTAATATACGTATTAGTAATTTATCA TTTGATCAAATACCCTTATTTGTGTGATCAGTTGGTATTACAGCATTATTATTACTTTTATCTCTTCCTGTATTAGCAGGAGCTATTACTATATTATTAACAGATCGAAATTTAAATACTT CATTTTTTGATCCTGCTGGAGGAGGAGATCCTATTCTTTATCAACACTTATTT
Type material. Holotype: ♂ currently deposited in the National Museum of Natural History , Washington, DC, USA [ USNM], illustrated in Fig. 10c, bears four printed labels: three white [ PERU: Cuzco 1194 m. | Quebrada Santa Isabel | Cosnipata Valley 4738 | 27-III-2016 Kinyon], [DNA sample ID: | NVG-19038C05 | c/o Nick V. Grishin ], [USNMENT | { QR Code} | 01544965], and one red [ HOLOTYPE ♂ | Ithomiola (Ithomiola) | perutanos Grishin].
Type locality. Peru: Cuzco, Cosñipata Valley, Quebrada Santa Isabel , elevation 1194 m, approximate GPS −13.017, −71.500 GoogleMaps .
name), perutanos means tanos from Peru. The name is a noun in apposition.
Distribution. Known only from the holotype collected in Cuzco, Peru.
| USNM |
Smithsonian Institution, National Museum of Natural History |
| V |
Royal British Columbia Museum - Herbarium |
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
|
Kingdom |
|
|
Phylum |
|
|
Class |
|
|
Order |
|
|
Family |
|
|
Genus |
