Hesperia pahaska hannawackeri, Zhang & Cong & Shen & Song & Grishin, 2023

Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina & Grishin, Nick V., 2023, Genomic analysis reveals new species and subspecies of butterflies, The Taxonomic Report of the International Lepidoptera Survey 11 (6), pp. 1-63 : 40-42

Hesperia pahaska hannawackeri Grishin, new subspecies

http://zoobank.org/ FC3A2704-0C47-4FEC-8476-2947275E52FD

( Figs. 42 part, 43)

Definition and diagnosis. Populations of Hesperia pahaska Leussler, 1938 ( type locality in USA: Nebraska, Sioux Co.) from southeastern Utah and southwestern Colorado are usually included in Hesperia pahaska martini MacNeill, 1964 ( type locality USA: California, San Bernardino Co., 4.5 mi SE of Ivanpah). However, they form a distinct clade in the Z chromosome tree and possess a distinct mitochondrial genome haplotype ( Fig. 42 red), representing distinct subspecies. This new subspecies differs from H. p. martini in better outlined and contrasting with fulvous ground color brown outer margins, smaller forewing subapical spots, and usually smaller ventral hindwing white spots; from the nominal Hesperia pahaska by less contrasting with the fulvous colors subapical and submarginal dorsal forewing spots, which are typically paler in H. p. pahaska , and usually more extensive fulvous areas penetrating fuscous margins in females on wings above (more similar to H. p. williamsi in this aspect) and from Hesperia pahaska williamsi Lindsey, 1940 ( type locality in USA: Arizona, Pima Co., Baboquivari Mts) by generally larger white ventral hindwing spots. Due to extensive phenotypic variation, definitive identification is provided by DNA, and a combination of the following characters is diagnostic in the nuclear genome: aly5021.3.8:C60T, aly7690.1.10:C45A, aly7690.1.10:C204T, aly4196.3.1:C333G, aly4196. 3.1:A415G and in COI barcode: T10C, T19C, G101A, 328C, T646C.

AACTTTATACTTTATTTTCGGTATTTGAGCTGGTATATTAGGAACTTCATTAAGTTTATTAATTCGAACAGAATTAGGTAATCCTGGATCTTTAATTGGAAATGACCAAATTTATAATACT ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTACCTTTAATATTAGGAGCTCCTGACATAGCTTTCCCACGTA TAAATAATATAAGATTTTGAATATTACCACCTTCATTAACATTATTAATTTCAAGAAGAATTGTAGAAAATGGTGCTGGAACAGGCTGAACTGTTTATCCTCCTTTATCCTCTAATATTGC TCACCAAGGATCTTCTGTTGATTTAGCAATTTTTTCTCTTCACTTAGCTGGAATTTCATCTATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAAAAACTTATCT TTTGATCAAATACCTTTATTTGTTTGATCTGTAGGAATTACAGCATTATTATTACTTTTATCTTTACCTGTATTAGCAGGAGCTATTACTATACTACTTACTGATCGAAATTTAAATACTT CTTTTTTCGATCCAGCAGGAGGAGGAGATCCAATTTTATACCAACATTTATTT

Type material. Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity, Florida Museum of Natural History, Gainesville, FL, USA [ MGCL], illustrated in Fig. 43a, bears four printed labels: two white [Pack Creek Day Use Area | La Sal Mountains | San Juan Co, UT | 2 June 2016 | Robb Hannawacker], [ Pahaska Skipper | male | Hesperia pahaska ], [DNA sample ID: | NVG-20045F06 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Hesperia pahaska | hannawackeri Grishin ]. Paratypes: 5♂♂ 2♀: USA: 1♀ Utah, San Juan Co., Poison Canyon, el. 8500', 5-Jun-2020, R. Hannawacker leg. (NVG-20045F05) ( Fig. 43b); Colorado: Mesa Co.: 2♂♂ Black Ridge Breaks, West Reef, 7050 ft, 24-25- May-2007, M. S. Fisher leg. (NVG-22055G08 & NVG-22055G09); and 1♂ BLM lands W of Gateway, Unaweep Seep Natural Area, 10-Sep-2017, Paul A. Opler and Evi M. Buckner-Opler leg. ( PAO 566); 1♂ Delta Co., 4.6-7.3 mi. SE of Austin, 6000-6600 ft, 12-Jun-1983, M. S. Fisher leg. (NVG-22055G10); 1♂ 1♀ Montrose Co., Gunnison Gorge NWA, Wave-Eagle Trail Loop, 6000-6300 ft, 1- and 3-Jun-2016, M. S. Fisher leg. (NVG-22055G11 & NVG-22055G12).

Type locality. USA: Utah, San Juan Co., La Sal Mountains, Pack Creek Picnic Area .

Etymology. The name honors Robb Hannawacker, the collector of the holotype and a female paratype from Utah. Robb is a dedicated Lepidopterist and the author of the book on the butterflies of southeastern Utah. He helped our lab tremendously with genomic studies of butterflies from his region (southeastern Utah) by collecting specimens and connecting us with others who can help further. The name is a masculine noun in the genitive case.

Distribution. Southeastern Utah and southwestern Colorado in the USA.