Gorgythion guyanus, Zhang & Cong & Shen & Song & Grishin, 2023

Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina & Grishin, Nick V., 2023, Genomic analysis reveals new species and subspecies of butterflies, The Taxonomic Report of the International Lepidoptera Survey 11 (6), pp. 1-63 : 35-37

Gorgythion guyanus Grishin, new species

http://zoobank.org/ 75920045-0024-46CF-83F0-F53371D32E59

( Figs. 34 part, 35, 36)

Definition and diagnosis. Genomic analysis of Gorgythion Godman & Salvin, 1896 ( type species Helias pyralina Möschler, 1877 ) reveals that a specimen from Guyana (NVG-15043F10) ( Figs. 34 magenta, 35) while being sister to Gorgythion begga (Prittwitz, 1868) ( type locality in Brazil: Rio de Janeiro) ( Fig. 34 blue), is not grouping closely with any of the described species ( Fig. 34) and therefore is new. It exhibits COI barcode differences of 2.4% (16 bp) from Gorgythion begga pyralina (Möschler, 1877) ( type locality in Suriname). This new species keys to E.36.1(a) in Evans (1953) and differs from its relatives in nearly unmarked dark-brown dorsal hindwing with convex outer margin, rounder than in Gorgythion plautia (Möschler, 1877) ( type locality in Suriname) ( Fig. 34 cyan), ventral hindwing without white area towards tornus, forewing not prominently truncate or produced at the apex, with developed markings and broad pale-brown areas ( Fig. 35); left valva broader at the base, and expansion of its ampulla curved inward, appearing truncate in lateral view ( Fig. 36). Due to unknown phenotypic variation, definitive identification is provided by DNA, and a combination of the following characters is diagnostic in the nuclear genome: aly1313.36.6:C75T, aly 1497.9.9:A87G, aly361.8.3:T111C, aly361.8.3:C126T, aly13198.6.3: G318C, aly 1204.4.2:G54G (not A), aly 1166.4.2:A30A (not C), aly 1166.4.2:T42T (not C), aly770.15.7:A12A (not G), aly770.15.7:G30G (not A) and in COI barcode: T59C, T172T, A181G, T280T, T463C, T574C.

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACCTCTTTAAGATTACTAATTCGAACTGAATTAGGTAATCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGGGGATTTGGAAATTGACTTGTTCCATTAATATTAGGAGCCCCTGATATAGCATTCCCCCGAA TAAATAATATAAGATTTTGACTTTTACCTCCTTCCCTTATATTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTTTATCCTCCTCTTTCAGCTAATATTGC CCATCAGGGGGCATCTGTAGATTTAGCTATTTTTTCCCTTCATTTAGCTGGAATTTCATCAATTTTAGGAGCTATTAATTTTATTACAACAATTATTAACATACGAATTAGAAATTTATCT TTTGATCAAATACCATTATTTGTTTGAGCAGTAGGTATTACTGCATTACTTTTATTATTATCATTACCTGTTTTAGCAGGTGCTATTACCATATTATTAACAGATCGAAATTTAAATACAT CATTTTTTGACCCTGCTGGTGGAGGAGATCCTATTTTATATCAACATTTATTT

Type material. Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity, Florida Museum of Natural History, Gainesville, FL, USA [ MGCL], illustrated in Fig. 35, bears five labels: four white [ GUYANA: ESSEQUIBO | Mt. Wokomung, 3500 ft. | XI,1993; S. Fratello], [Genit. Vial No. | SRS-4628], [Allyn Museum | Acc. 1994-5], [DNA sample ID: | NVG-15043F10 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Gorgythion | guyanus Grishin].

Type locality. Guyana: Essequibo, Mt. Wokomung , elevation 3500 ft.

Etymology. The name is given for the country of the type locality. The name is a masculine adjective.

Distribution. Currently known only for the holotype collected in Guyana.