Eurythenes sigmiferus, D’Acoz, Cédric D’Udekem & Havermans, Charlotte, 2015
publication ID |
https://doi.org/10.11646/zootaxa.3971.1.1 |
publication LSID |
lsid:zoobank.org:pub:61D379B9-D9BA-41FB-B6A9-57BF87131B42 |
DOI |
https://doi.org/10.5281/zenodo.5470192 |
persistent identifier |
https://treatment.plazi.org/id/852B87B0-FFE7-FFEA-6CE3-FF1BFBD42033 |
treatment provided by |
Plazi |
scientific name |
Eurythenes sigmiferus |
status |
sp. nov. |
Eurythenes sigmiferus sp. nov.
( Figs 47 View FIGURE 47 –52)
Eurythenes gryllus .—? Barnard, 1961: 35, in part, fig. 5.—? Bowman & Manning, 1972: 193, figs. 2–5, in part ( Guadeloupe and Andros material only).— Escobar-Briones et al., 2010: 177, in part.
Eurythenes gryllus clade Eg6.— Havermans et al., 2013: 12 –13, fig. 5 (1A).
Material examined. HOLOTYPE. RV Meteor, expedition DIVA 3, ME 79-1, sta. 542, 26°33'21"S 035°11'29"W, 4480 m, baited trap, 21.vii.2009: 1 specimen, 53 mm, fixed first 96% denatured ethanol, coll. Ed Hendrycks, DZMB-HH 7991, ZMH K 44286 View Materials ; BraB-8, EG-2101108, JX887070 View Materials (16S).
Voucher DNA sequences. HOLOTYPE, BraB-8, EG-2101108.
16S (GenBANK JX887070 View Materials ):
TGCTATAAGGGTAGTGTATGGTAAGGCCTGCCCAGTGATTAATTAAACGGCTGCGGTATATTGACCGTG CTAAGGTAGCATAGTCATTTGTCTTTTAATTGGGGGCTGGAATGAAGGGTTTAACAAAAGATAGTGTCT TTATTTTAAATTTGTAATTTATAATAAGGGTAAAAATACTTTGGTGTGATTAAGGGACGACAAGACCCTA AAAGCTTTATTTTTAATATGAGTTTGAGTTTAAAATAAAACAGAAAGTTTAACTGGGGTAGTTTTTTTG TAAAATCTGAGGTTGTAAAAGGCATATAAAATGGAGTTAGGTTCTTTAGATAAGGATAATTTGAGTGAG TTACTTTAGGGATAACAGCGTAATAGTCCTAGGGAGATCGTATCTATGGGATTGATTGCGACCTCGATG TTGAATTAAAAGCTCAGTGTAGAGCAGAAGCTACGGGGTGAGGGTTTGTTCAACCTTTAAATTTTTA
Type locality. Southwestern Atlantic, off Brazil, Brazil Basin, 26°33'21"S 035°11'29"W, 4480 m.
Etymology. Sigmiferus , - a, - um, adjective created in combining Sigma , which is the eighteenth letter of the Greek alphabet, and the suffix - ferus, which means bearing. The name alludes to the dorsal sigmoid profile of most segments of the pereon and pleosome of the species.
Description. Holotype, 53 mm, presumed female.
Body: pereonites 2–7 and pleosomites 1–3 posteriorly carinate; the most carinate body segment, i.e. pereonites 6–7 and pleosomites 1–3 have a sigmoid profile: they present a slight anterior concavity (which is deeper in pleosomite 3).
Head: anterior lobe of head strongly produced; ventral corner of eye blunt and pointing obliquely backwards.
Mandible: article 2 of palp posteriorly not expanded and distally not tapering.
Maxilliped: Inner plate with 9–10 nodular spines, which are distinctly protruding.
Gnathopod 1: coxa straight anteriorly; basis broad, 2.9 x as long as wide; palm well developed, weakly produced.
Gnathopod 2: coxa broad and weakly curved ventrally; propodus stout, expanded distally, 2.4 x as long as wide, palm distinctly curved and intrusively oblique, defined by 4 spines.
Pereopod 3: Coxa rather narrow, 1.9 x as deep as wide; basis stout, 3.1 x as long as wide; propodus stout, 4.5 x as long as wide; dactylus stout.
Pereopod 4: coxa fairly broad, 1.1 x as deep as wide; junction between anterior and ventral border rounded but well distinct; ventral border nearly straight; posteroventral border with inconspicuous concavity, scarcely oblique; leg almost identical with pereopod 3.
Pereopod 5: basis with posterior border slightly crenulated; merus of normal width, 1.8 x as long as wide, with posterior border forming a regular curve; propodus rather stout, 5.6 x as long as wide, with 9 groups of spines anteriorly; dactylus rather stout.
Pereopod 6: missing in the only specimen available (used for the DNA study).
Pereopod 7: basis stout, with posterior border expanded normally, with posterior border strongly crenulated, with ornamentation of anterior border normal, 1.5 x as long as wide, with posterodistal corner of lobe a bit produced and bluntly angular, ratio length of lobe of basis / total length of basis = 0.21; merus stout, 1.6 x as long as wide, with posterior border forming a regular curve; propodus stout, 5.3 x as long as wide, with 9 groups of spines anteriorly; dactylus rather stout.
Epimeron 3: weakly rounded ventrally, without posteroventral tooth.
Uropod 3: spines of distolateral angle of peduncle rather long and slender.
Colour pattern. Colour of holotype unrecorded. Photographs previously uploaded on the WWW of specimens possibly belonging to E. sigmiferus sp. nov. (crested Eurythenes ) show completely white animals with pale yellowish eyes; e.g. ECOMARE Cruise diary, 7th August 2007, http://www.oceanlab.abdn.ac.uk/blog/?p=244 [accessed 21.x.2011].
Size. The holotype is 53 mm long. The two possible E. sigmiferus specimens recorded by Barnard (1961) as E. gryllus were respectively 50 mm and 75 mm long. The possible E. sigmiferus specimen of the ECOMARE Cruise previously illustrated at http://www.oceanlab.abdn.ac.uk/blog/wp-content/fig-1.JPG [accessed 21.x.2011] was nearly 140 mm long.
Distribution and depth range. The only absolutely certain record of the species is that of the holotype in the Brazil Basin (26°33'21"S 035°11'29"W) at 4480 m. However, the species may be widely distributed, since it presumably also occurs in the Gulf of Mexico around 3300 m depth, based on Escobar-Briones et al. (2010), who record Eurythenes specimens with extremely similar DNA sequences ( Havermans et al. 2013).
Biology. The species is a scavenger, which sometimes enters baited traps.
Remarks. Besides genetically confirmed records of E. sigmiferus sp. nov., there is a number of records of crested Eurythenes , which are possibly conspecific but require further studies. Barnard (1961) recorded and illustrated two crested Eurythenes specimens collected in the Indian Ocean, off Natal at 29°39'S 37°01'E, 4880– 5090 m, which could be E. sigmiferus . Bowman & Manning (1972) also recorded crested Eurythenes (without giving illustrations of the crests) from Guadeloupe and Andros Island, but from a much shallower depth (around 1800 m); their identity with E. sigmiferus sp. nov. seems possible but requires confirmation, the concept of “crest” remaining too imprecise when not substantiated by illustrations. There are also several pictures accessible on WWW showing Eurythenes specimens with a dorsal crests more or less similar to those of E. sigmiferus sp. nov. The specimen illustrated at http://lysianassidae.myspecies.info/sites/lysianassidae.myspecies.info/files/ KAH0910_6%20 Eurythenes .jpg [accessed on 23.ix.2014] comes from the Kermadec Trench, 36°10.07’S 179°00.27’W, 6000 m, and that of http://lysianassidae.myspecies.info/sites/lysianassidae.myspecies.info/files/ Eurythenes %202.JPG [accessed on 23.ix.2014] from the Peru-Chile Trench, 04°27.016’S 81°54.719’W, 5329 m] (Kilgallen comm. pers.). The specimen previously illustrated by a photograph at http://www.oceanlab.abdn.ac.uk/ blog/wp-content/fig-1.JPG [accessed 21.x.2011] presumably comes from the Atlantic Ocean, possibly from the Mid-Atlantic Ridge. If it is genetically confirmed that these specimens are indeed E. sigmiferus sp. nov., this would mean that it is a cosmopolitan tropical/subtropical abyssal (and possibly hadal) species.
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
Kingdom |
|
Phylum |
|
Class |
|
Order |
|
SuperFamily |
Lysianassoidea |
Family |
|
Genus |
Eurythenes sigmiferus
D’Acoz, Cédric D’Udekem & Havermans, Charlotte 2015 |
Eurythenes gryllus
Havermans 2013: 12 |
Eurythenes gryllus
Escobar-Briones 2010: 177 |
Bowman 1972: 193 |
Barnard 1961: 35 |