Euriphellus ecuadoricus, Zhang & Cong & Shen & Song & Grishin, 2023

Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina & Grishin, Nick V., 2023, Genomic analysis reveals new species and subspecies of butterflies, The Taxonomic Report of the International Lepidoptera Survey 11 (6), pp. 1-63 : 30-31

Euriphellus ecuadoricus Grishin, new species

http://zoobank.org/ 462B5465-AC20-4876-93A3-4803BB75CD2C ( Figs. 26 part, 27b, d, 28c–d)

Definition and diagnosis. Genomic analysis of Euriphellus Austin, 2008 ( type species Papilio euribates Stoll, 1782 ) reveals that four specimens from Colombia and Ecuador form a clade sister to several Euriphellus species that is genetically differentiated from them ( Fig. 26). Therefore, these specimens belong to species distinct from the rest. The two pairs of specimens are genetically differentiated from each other, e.g., COI barcode differences of 4.9% (32 bp) between them, and belong to two different new species. The one from eastern Ecuador is described here, and the one from western Colombia is described above. The new species from Ecuador keys to D.4.2(b) in Evans (1952), and differs from its relatives by the following combination of characters in males: wings not as rounded as in Euriphellus mena (Evans,

submarginal hyaline spots in cells M1-M2, M2-M3, and R3 - R4 , and larger hyaline subapical spots in cells R4 - R5 and R5 -M1, hindwing with five weaker-developed and separated postdiscal brown spots on dorsal side, one in each cell between veins RS and CuA2, ventrally with prominent yellow spots, but not near the base of cell Sc+ R1 -RS ( Fig. 27b), tegumen broader in dorsal view, harpe shorter than in Euriphellus colombiensis sp. n., only weakly humped along ventral margin, no dorsal keel, and narrows to a point, ampulla with a rounded thumb-like process with somewhat irregular margins ( Fig. 28c, d); and female with smaller discal forewing hyaline spots, the spot in cell M3-CuA1 offset distad from the spot in cell CuA1-CuA2 not overlapping with it ( Fig. 27d). Due to unknown phenotypic variation, definitive identification is provided by DNA, and a combination of the following characters is diagnostic in the nuclear genome: aly331.26.8:C109A, aly331.26.8:G267A, aly331.26.8: T291 C, aly536.154.1:A618G, aly536. 154.1: T631 C and in COI barcode: A28G, T91 A, A229G, C343A, G474A, A538G, T544 A, T607 C, T634 C. Barcode sequence of the holotype. Sample NVG-18057G01, GenBank OR 837730, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGGGCAGGAATACTAGGAACTTCTTTAAGTTTATTAATTCGAACTGAATTAGGAACTCCCGGTTCATTAATTGGAAATGATCAAATTTATAATACT ATTGTTACAGCCCATGCTTTTATTATAATTTTCTTTATAGTAATACCTATTATAATTGGAGGATTTGGAAACTGATTAGTACCATTAATATTAGGAGCCCCAGATATGGCTTTTCCACGAA TAAACAATATAAGATTTTGATTACTTCCACCTTCTTTAATATTATTAATTTCAAGAAGAATTGTTGAAAATGGAGCAGGAACAGGATGAACAGTTTATCCACCTTTATCTGCTAATATTGC TCACCAAGGATCTTCAGTTGATTTAGCAATTTTTTCACTTCATTTAGCTGGAATTTCTTCAATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAAAAACTTATCT TTTGATCAAATACCATTATTTGTTTGAGCTGTAGGAATTACAGCTTTATTATTGCTTCTATCTTTACCTGTATTAGCAGGTGCAATTACTATATTATTAACAGACCGAAATTTTAATACAT CCTTTTTTGATCCTTCTGGAGGAGGAGACCCTATTTTATATCAACATTTATTT

Type material. Holotype: ♂ deposited in the Zoologische Staatssammlung München, Germany [ ZSMC], illustrated in Fig. 27b, bears five printed labels: four white [Canelos | Ecuador or.], [Collection | v.Rosen], [DNA sample ID: | NVG-18057G01 | c/o Nick V. Grishin ], [DNA sample ID: | NVG-23012A09 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Euriphellus | ecuadoricus Grishin]. The first NVG number corresponds to a sampled leg, and the second is for the abdomen DNA extraction followed by genitalia dissection. Paratype: 1♀ with the same data as the holotype (NVG-18057G02, GenBank barcode OR837731, Fig. 27d).

Type locality. Ecuador: Canelos .

Etymology. The name is given for the country of the type locality. The name is a masculine adjective.

Distribution. Currently known only from Ecuador.