Euriphellus colombiensis, Zhang & Cong & Shen & Song & Grishin, 2023

Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina & Grishin, Nick V., 2023, Genomic analysis reveals new species and subspecies of butterflies, The Taxonomic Report of the International Lepidoptera Survey 11 (6), pp. 1-63 : 28-30

Euriphellus colombiensis Grishin, new species

http://zoobank.org/ 466927D6-598F-4C73-8835-F3D4305F40BB ( Figs. 26 part, 27a, c, 28a–b)

Definition and diagnosis. The Z chromosome analysis of Euriphellus Austin, 2008 ( type species Papilio euribates Stoll, 1782 ) reveals that four specimens from Colombia and Ecuador form a clade sister to several Euriphellus species that is genetically differentiated from them ( Fig. 26a). Therefore, these specimens belong to species distinct from the rest. The two pairs of specimens are genetically differentiated from each other, e.g., COI barcode differences of 4.9% (32 bp) between them (possible introgression with Euriphellus lama ( Evans, 1952) , Fig. 26b), and belong to two different new species. The one from western Colombia is described here, and the one from eastern Ecuador is described below. The new species from Colombia keys to D.4.2(b) in Evans (1952), and differs from its relatives by the following combination of characters in male: dorsal wing color yellower in hue, forewing without submarginal hyaline spots in cells M 1 -M 2, M 2 -M 3, or R 3 -R 4, only two yellow hyaline subapical spots in cells R 4 -R 5 and R 5 -M 1, hindwing with six well-developed and nearly collected into a band postdiscal brown spots on dorsal side, one in each cell between veins RS and 1A+2A, ventrally with prominent yellow spots, including near the base of cell Sc+R 1 -RS ( Fig. 27a), tegumen narrower in dorsal view, harpe= longer= than= in= relatives,= humped= along= ventral= margin,= expanded= into= a= keel= with= several= small=teeth=on=dorsal=side=and=narrows=to=a=point,=ampulla=with=a=nearly=square=process,=flattened= along= its= somewhat= irregular= dorsoposterior= margin= (Fig.= 28a, b);= and= female= with= larger= discal= forewing=hyaline=spots,=the=spot=in=cell=M 3 -CuA 1 =overlaps=the=spot=in=cell=CuA 1 -CuA 2 =by=most=of=its= width= ( Fig. 27c). Due to unknown phenotypic variation, definitive identification is provided by DNA, and a combination of the following characters is diagnostic in the nuclear genome: aly2582.35.2:G1861A, aly2582.35.2:C1862G, aly767.18.5:A88T, aly767.18.5:T117A, aly54.32.1:C215G and in COI barcode: A181G, T259C, C343T, T364C, T376A, T484T, T553A.

Barcode sequence of the holotype. Sample NVG-18052E08, GenBank OR837728, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATGTTAGGAACTTCTTTAAGTTTACTAATTCGAACTGAATTAGGAACTCCAGGATCTTTAATTGGAAATGATCAAATTTATAATACT ATTGTTACAGCCCATGCTTTTATTATAATTTTTTTTATAGTAATGCCTATTATAATTGGGGGATTCGGAAACTGATTAGTACCATTAATATTAGGAGCCCCAGATATAGCTTTTCCACGAA TAAATAATATAAGATTCTGATTACTTCCCCCTTCTTTAATATTATTAATTTCAAGAAGAATCGTTGAAAATGGAGCAGGAACAGGATGAACAGTTTATCCTCCTTTATCTGCTAACATTGC CCATCAAGGATCATCAGTTGATTTAGCAATTTTTTCTCTTCACTTAGCTGGTATTTCTTCAATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAGAAACTTATCT TTCGATCAAATACCATTATTTGTTTGAGCTGTAGGAATTACAGCTTTATTATTACTTCTCTCTTTACCAGTACTAGCAGGTGCAATTACTATATTATTAACAGACCGAAATTTTAATACAT CTTTTTTTGATCCTTCTGGAGGAGGAGATCCTATTTTATATCAACATTTATTT

Type material. Holotype: ♂ deposited in the Museum für Naturkunde, Berlin, Germany [ MFNB], illustrated in Fig. 27a, bears four printed labels: 1 st green, two white [W.Columb. | Rio Dagua | 600- 1000m | W.Hopp S. | 2 - 5] (the last line is rotated 90° to the left and printed on the right margin of the label), [DNA sample ID: | NVG-18052E08 | c/o Nick V. Grishin ], [DNA sample ID: | NVG-22111G11 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Euriphellus | colombiensis Grishin]. The first NVG number corresponds to a sampled leg, and the second is for the abdomen DNA extraction followed by genitalia dissection. Paratype: 1♀ with the same data as the holotype (NVG-18052E11, GenBank barcode OR837729, Fig. 27c).

Type locality. Colombia: Río Dagua , 600–1000 m .

Etymology. The name is given for the country of the type locality. The name is a masculine adjective.

Distribution. Currently known only from Colombia.