Emesis ( Mandania ) mandarina Grishin, 2025
|
publication ID |
https://doi.org/10.5281/zenodo.16570612 |
|
publication LSID |
lsid:zoobank.org:pub:504B8C6D-D4AA-4489-8CE4-A636BC5F5426 |
|
DOI |
https://doi.org/10.5281/zenodo.16570616 |
|
persistent identifier |
https://treatment.plazi.org/id/42116960-6031-B33D-FE2E-203C5BB9BE10 |
|
treatment provided by |
Felipe |
|
scientific name |
Emesis ( Mandania ) mandarina Grishin |
| status |
sp. nov. |
Emesis ( Mandania) mandarina Grishin , new species
http://zoobank.org/ 98452F55-3EB2-4B5A-84B1-4D1C8FF074BE
( Figs. 2 View Fig part, 3)
Definition and diagnosis. Genomic analysis reveals that several specimens from Santa Catarina, Brazil, initially identified as Emesis ( Mandania) mandana (Cramer, 1780) ( type locality in Suriname) are genetically differentiated from it at the species level ( Fig. 2 View Fig ); e.g., their COI barcodes differ by 0.9% (6 bp, barcodes do not differ strongly in this species group ( Zhang et al. 2024, 2025b)), and, therefore, they represent a new species. This new species is similar to its sister E. mandana in having redder colors of the dorsal side in males, but differs from it by a more uniformly colored orange ventral side of the wings without more prominent redder and broader margins and the lack of a defined ventral hindwing spot at the tornus. Males ( Fig. 3a, c View Fig ) have smaller and more weakly expressed submarginal dark dots, betterseparated dark markings in the postdiscal row on the ventral side, and typically darker (maroon-toned) background color of the dorsal side. Females ( Fig. 3b View Fig ) may have a rounder forewing with a more convex outer margin and a less prominently concave hindwing outer margin at the vein M 2, narrower dashes and crescents in the discal band on the dorsal side with a dash in cell M 2 -M 3 being more strongly offset distad and aligned with the dash in cell M 3 -CuA 1, and paler marginal areas on the ventral side. Due to its cryptic nature and unexplored individual variation, this species is best identified by DNA, with diagnostic base pairs in the nuclear genome: cne4739.1.2:C183T, cne339.14.2:A330T, cne339.14.2:C435T, cne37103.1.5: T462A, cne37103.1.5:T468C; and the COI barcode: T367C, A379C, T578C, T610C.
Barcode sequence of the holotype. Sample NVG-18044E12, GenBank PV892283, 658 base pairs: AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTTGGAACTTCACTAAGATTATTAATTCGAATAGAATTAGGAACTTCAGGATCATTAATTGGTGATGATCAAATTTATAATACT ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTACCATTAATACTAGGAGCCCCAGATATAGCTTTTCCACGAA TAAATAATATAAGATTTTGACTTTTACCTCCATCTTTAATTTTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTGTACCCCCCACTTTCTTCTAATATTGC TCACGGAGGTTCTTCCGTAGATTTAGCTATTTTTTCTTTACATTTAGCAGGAATTTCCTCAATTTTAGGTGCAATTAACTTTATTACTACTATTATTAATATACGAATTAATAATATATCA TTTGATCAAATACCTTTATTTGTTTGATCTGTAGGAATTACAGCTCTTCTATTATTATTATCTTTACCTGTTTTAGCTGGAGCTATTACTATACTATTAACAGATCGAAATTTAAATACAT CATTCTTTGATCCTGCTGGTGGTGGTGATCCTATTTTATATCAACATTTATTT
Type material. Holotype: ♂ deposited in the National Museum of Natural History , Washington, DC, USA ( USNM), illustrated in Fig. 3a View Fig , bears the following eight rectangular labels (1 st handprinted, others printed with handwritten text shown in italics; 4 th blue, 5 th yellow, the last red, others white): [ Joinville | 18·IX·1982], [ StaCatharina | Brazil], [ Presented by | Robert E. Aronheim], [ JHALL | -00 05], [ LEGS AWAY | FOR DNA], [DNA sample ID: | NVG-18044E12 | c/o Nick V. Grishin], [USNMENT | { QR Code} | 01466379], and [HOLOTYPE ♂ | Emesis ( Mandania) | mandarina Grishin ]. Paratypes: 1♂ and 2♀♀ from Brazil, Santa Catarina (last one likely mislabeled): 1♂ NVG-25013H04 Joinville , 4-Mar-1985, H. Miers leg. [ MGCL] ( Fig. 3c View Fig ); 1♀ NVG-24032A05 Blumenau, old, coll. Staudinger [ MFNB] ( Fig. 3b View Fig ); and 1♀ NVG-24032A12 “ Colombia | R. Magdalena s”, old , ex coll. H. Stichel, number 3280 [ MFNB] .
Type locality. Brazil: Santa Catarina, Joinville .
Etymology. The name is a fusion given to this relative of mand [ana from Santa Cat] arina, and is treated as a noun in apposition.
Distribution. Currently known only from Santa Catarina in Brazil.
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
|
Kingdom |
|
|
Phylum |
|
|
Class |
|
|
Order |
|
|
Family |
|
|
Genus |
