Catharylla serrabonita T. Leger & B. Landry

Leger, Theo, Landry, Bernard, Nuss, Matthias & Mally, Richard, 2014, Systematics of the Neotropical genus Catharylla Zeller (Lepidoptera, Pyralidae s. l., Crambinae), ZooKeys 375, pp. 15-73 : 41-43

Catharylla serrabonita T. Leger & B. Landry sp. n. Figs 6, 21-26, 39, 45, 46

Type material.

Holotype. ♂, with labels as follows: "BRASIL: BA, Camacan | Res[erva]. Serra Bonita | 15°23'S, - 39°33'W, | 800m, 06.iv.2011 | B. Landry, V. Becker"; "HOLOTYPE | Catharylla serrabonita | T. Léger & B. Landry" [red label]. Deposited in Becker Collection.

Paratypes. 21 ♂, 1 ♀. BRAZIL: 5 ♂ (1 used for DNA barcoding BC MTD 01843, 1 with genitalia on slide BL 1745), Espírito Santo, Linhares, 40m, 25-30.i.1998 (V. O. Becker n°113929) (Becker Coll., USNM); 2 ♂, 1 ♀ (♀ with genitalia on slide BL 1759) with same except 20-29.ii.1992 (V. O. Becker n°81552) (Becker Coll., USNM); 2 ♂ with same data as holotype except 05-09.iv.1992 (V. O. Becker n°82486) (USNM); 10 ♂ (1 in alcohol, thorax used for DNA sequencing LEP 979, genitalia on slide TL 7, wing on slide TL 8) Bahia, Camacan, Serra Bonita Reserve, 15°23'S, 39°33'W, 800 m, B. Landry, V. O. Becker, 1.iv.2011 (1 ♂), 2.iv.2011 (2 ♂), 3.iv.2011 (1 ♂, genitalia on slide BL 1776), 5.iv.2011 (3 ♂), 6.iv.2011 (1 ♂), 7.iv.2011 (1 ♂) (MHNG); 1 ♂ with same data except vii.2010 (V. O. Becker) (Becker Coll.); 1 ♂ (used for DNA sequencing and barcoding LEP 970, BC MTD 01887, genitalia on slide TL 6) Bahia, Porto Seguro, A. d’Ajuda, 16°27'S, 39°03'W, 20 m, 12.vii.2009 (V. O. Becker n°144140) (Becker Coll.).

COI barcode sequence of holotype LEP 979 (516 bp): TAGTTGGAACATCATTAAGACTATTAATTCGAGSAGAGTTAGGGAATCCTGGATCTCTTATTGGAGATGATCAAATTTATAATACTATTGKAACAGCTCATGSATTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGTGGATTTGGAAACTGACTAGTTCCATTAATATTAGGAGCCCCAGACATAGCTTTCCCCCGAATAAATAATATAAGATTTTGATTACTCCCCCCCTCTTTAACCCTTTTAATTTCCAGAAGAATTGTAGAGAATGGAGCTGGAACAGGATGAACGGTTTACCCCCCCCTTTCATCTAATATTGCTCATAGKGGAAGATCTGTAGATTTAGCAATTTTTTCTCTTCATTTAGSAGGAATTTCATCAATTTTAGGAGCAATTAATTTTATTACAACAATTATTAATATACGAATTAATAATTTATCTTTTGATCAAATACCGTTATTTGTCTGATCAGTTGGTATTACAGCTTTACTCCTTCTTTTATCTTTAC

Diagnosis.

From Catharylla coronata and Catharylla tenellus , Catharylla serrabonita can be separated by the zigzagging median transverse line with the short triangular dent at CuA2 and the pronounced creamy color of the hindwing. The male genitalia provide the best discriminant characters: in Catharylla serrabonita , the transtilla forms a pair of sclerotized arms bent inward in distal 1/4 and with a string of long spines of same length medially along it, whereas it forms a pair of short, narrow sclerotized arms with pointed tips projecting posterad, and with a pair of brushes directed medio-ventrally in Catharylla tenellus , and two sclerotized arms slightly bent inward distally, with a row of short spines increasing in size from base to apex in Catharylla coronata , and the juxta is apically narrow and pointed whereas it is triangular and regularly narrowed in Catharylla coronata and Catharylla tenellus . In female genitalia, the anterior angle of sternite VIII is projected anterad into a rounded protrusion covered with short spinules in Catharylla serrabonita , whereas it is projected downward in Catharylla tenellus and it is not projected in Catharylla coronata .

Description.

Male (n = 21) (Fig. 6): Head white with ochreous chaetosemata. Antenna brown with whitish-ochreous scales and patch of brown scales at base. Maxillary palpus light ochreous,with patches of dark brown scales at 1/3 and 2/3, white tipped. Labial palpus: 1.7-2.5 mm long; light ochreous, white tipped. Thorax white, with ochreous patch at collar. Foreleg coxa white; femur white, dorsally dark brown; tibia and tarsomeres ochreous, distally ringed with brown. Midleg and hindleg white to light ochreous; tarsomeres II–V ochreous, brown on upperside, with white ringed tips. Forewing length: 10-14 mm; costal line ochreous; median transverse line ochreous to brown, zigzagging with short brown pronounced spot at M1 and short triangular dent at CuA2; subterminal transverse line ochreous to brown, regularly curved up to CuA2, then curved again; R5 faintly marked apically with ochreous; outer margin ochreous with 7 more or less triangular and connected dark brown spots between veins; fringes brass colored; underside ochreous, outer margin with pronounced spots. Hindwing cream-coloured, usually with more or less connected marginal brown spots between Sc+R1, Rs, M1, M2, M3, CuA1 and CuA2; fringes white; underside light ochreous, with marginal spots pronounced.

Tympanal organs (n = 4): Transverse ridge more or less rounded, medially slightly flattened. Tympanic pocket extending faintly beyond transverse ridge, rounded. Tympanic drum glomerular, not reaching transverse ridge.

Male genitalia (n = 4) (Figs 21-26): Uncus about as long as tegumen arms, downcurved; uncus arms connecting basally, with ventro-lateral tuft of setae at base; dorsal furrow pronounced medially with row of few hairs on each side; apex rounded, slightly indented medially, slightly convex ventro-apically. Gnathos arms connecting at 1/3; main shaft slightly downcurved with apex pointing upward. Tegumen arms regularly enlarging toward apex, connection at about 4/5 length of arms. Costa with apically rounded arm pointing postero-dorsally; cucullus curved upward in distal 1/3, with apex rounded. Juxta triangular, narrowing in distal 1/4 with bell-shaped ventro-lateral projections, regularly curved with apex horizontally straightened; baso-lateral angles curved upward. Transtilla with two very large sclerotized arms projecting posterad, bent inward in apical 1/4, with longitudinal string of long spines medially. Phallus slightly S-shaped, with apex dorsally sclerotized; vesica covered with microspicules, without cornuti.

Female (n = 1): Labial palpi: 1.9 mm long. Forewing length: 14 mm. Frenulum triple.

Female genitalia (n = 1) (Fig. 39): Papillae anales straight, thick. Posterior apophyses 0.4 × length of papillae anales, narrow, wider at base. Intersegmental membrane between segment VIII and IX covered with microspines. Sternite VIII laterally about 5/3 length of tergite VIII; posterior margin of tergite VIII with line of setae; sternite VIII forming 2 triangular lobes regularly narrowing downward, not connected, densely covered with short spinules of same length; anterior angle of sternite VIII slightly projected anterad, rounded, covered with short spinules of same length. Anterior apophyses 0.03 × length of papillae anales. Sterigma membranous, covered with spinules. Ductus bursae about 3 × length of corpus bursae, narrow, basally directed downward and then bent upward. Corpus bursae elongate, ovoid, with one tiny signum.

Distribution.

The species occurs in Brazil (Bahia, Espirito Santo) (Figs 45 & 46).

Etymology.

The name comes from that of the Serra Bonita Reserve founded by Vitor O. Becker and Clemira de Souza. It is managed by Instituto Uiraçu in the State of Bahia, Brazil.

Notes.

Serra Bonita Reserve is located in the Atlantic Forest, in a hilly region of cacao plantations and scattered forest. Adults came late to light, usually after 23:00. Our molecular analysis of the COI barcode sequences highlighted that specimens from Serra Bonita respectively show 3.24 and 2.21 % base differences with those of Porto Seguro and Linhares. This divergence is possibly associated with slight morphological differences in male genitalia as shown in Figs 23-26. No females were found at Serra Bonita.