Hermeuptychia hermybius Grishin

Cong, Qian & Grishin, Nick V., 2014, A new Hermeuptychia (Lepidoptera, Nymphalidae, Satyrinae) is sympatric and synchronic with H. sosybius in southeast US coastal plains, while another new Hermeuptychia species - not hermes - inhabits south Texas and northeast Mexico, ZooKeys 379, pp. 43-91 : 60-66

Hermeuptychia hermybius Grishin sp. n. Figs 48-59, 60b, e, h, k, 61b, 62 a–m, 63 part, 64 q–z, 66 part, 67 part, 70

Description.

Male (n = 56, Figs 48-49, 52-56, 58-59) - holotype forewing length = 16 mm. Forewing triangular, rounded at apex and tornus, costal and outer margins convex, inner margin almost straight, mildly concave mediad, two discal cell veins budged at bases, vein 2A thickened basad. Hindwing rounded, almost circular. Wings dorsally dark-brown with sparse olive-beige overscaling and two darker-brown terminal lines. Wings ventrally pale-brown, paler towards inner margin of forewing, with extensive beige overscaling, particularly along veins in distal part in some specimens; submedial and postmedial darker- to rusty- and olive-brown lines and end-of-cell streak (smaller on hindwing) between them; hindwing postmedial line more undulate that in Hermeuptychia sosybius , with a stronger bend in M1-M2 cell; two terminal dark-brown evenly curved marginal lines, dark-brown sinuous submarginal line, more undulate than in Hermeuptychia sosybius , barely touching the eyespot in cell Cu1-Cu2, and row of submarginal eyespots basad of the sinuous line and posteriad of postmedial line, eyespots frequently reduced in size and are more uniformly sized than in Hermeuptychia sosybius ; usually largest eyespots black-centered and pupiled with pale-blue scales: on forewing, eyespots about the same size, frequently larger posteriad, but eyespot in cell M1-M2 (usually not the largest in size) and eyespot in cell R5-M1 (in some specimens) black-centered (more eyespots black centered in some specimens); on hindwing, largest eyespots in cells M1-M2 and Cu1-Cu2, a smaller one in cell Cu2-1A+2A, even smaller, but still black-centered and pale-blue pupilled in cell Rs-M1, and two smallest, usually without black, but in some specimens pale-blue pupilled eyespots in cells M2-M3 and M3-Cu1. Fringes monochrome, a little paler than the ground color of wings. Head, palpi, thorax and abdomen dark-brown above, paler and mostly beige beneath. Antennae dark-brown above with pale scales at segments, orange-brown at the club, beneath beige basad, orange-brown in distal half. Legs brown with beige scales. Male genitalia (n = 19, Figs 60b, e, h, k, 61b, 62 a–m, 63 part) - typical for the genus, very similar to those of Hermeuptychia sosybius . Tegumen dome-like, rounded at margins. Uncus leaf-shaped in dorsal view, almost flat distally but convex basally in lateral view, with a well-developed thin, membranous carina in basal half; apex of uncus appears truncated in dorsal view and sides usually less concave than in Hermeuptychia sosybius . Gnathos arms thin, wide apart, divergent, about the same length as uncus. Valvae narrow, but typically broader than in Hermeuptychia sosybius , elongated with thin cuculli extending past gnathos usually farther than a quarter of their length; cucullus usually with four apical teeth; cucullus ventrally with inner medial bulge. Saccus about the same length as cucullus, narrow. Aedeagus elongated, bent around its middle, with a medium length phallobase. Female (n = 45, Figs 50-51, 57) - similar to male in facies, with slightly more rounded wings and dorsally paler in color. Female genitalia (n = 9, Fig. 64 q–z) as in Hermeuptychia sosybius , with pale, yellowish, weakly sclerotized and broad, rounder anteriad, cup-like antrum slightly asymmetric to the left. Ostium bursae ellipsoidal, its ventral margin shorter or equal to dorsal margin. Ductus and corpus bursae each in length similar to antrum; corpus bursae with two signa, spines in a signum narrow, leaf-shaped, placed in three to five irregular rows.

Barcode sequences.

Full length DNA barcodes were obtained for 19 paratypes (GenBank accessions: KJ025569-KJ025587). The most common haplotype present in 17 sequences (including all 5 barcoded siblings of the holotype) is exemplified by the voucher NVG-1603, Genbank accession KJ025569, 658 base pairs:

AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATAATTGGAACATCATTAAGTTTAATTATTCGAATAGAGTTAGGTAATCCAGGATTTT TAATTGGAGATGACCAAATTTATAACACTATTGTTACAGCCCATGCTTTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGTAATTGACTTATTCCTTTAATATTAGGAGCTCCTGATATAGCTTTCCCACGTATAAATAATATAAGATTTTGATTATTACCCCCATCTTTAATTTTATTAATTTCTAGTAGTATTGTAGAAAATGGAAGTGGAACAGGATGAACTGTTTACCCCCCTCTTTCATCTAATATTGCCCATAGAGGTTCTTCAGTAGATTTAGCAATTTTTTCTCTTCATTTAGCTGGAATTTCATCAATTTTAGGAGCCATTAATTTTATTACAACAATTATTAATATACGAATTAATAATATATCTTATGATCAAATACCTTTATTTATTTGAGCTGTAGGAATTACAGCTCTTCTTTTACTTCTCTCATTACCTGTTTTAGCAGGAGCTATTACCATACTTCTTACTGATCGAAATTTAAATACATCATTTTTTGACCCTGCAGGAGGAGGAGATCCTATTTTATATCAACATTTATTT

The 2 remaining sequences were identical to each other (Fig. 66b) and differed from the sequence shown above by a single base pair (0.15%). Barcode from the oldest and westernmost specimen (TX: Laredo, 15-Apr-1949) was additionally verified with both DNA ID tags as described in Materials and methods section and confirmed to be this species.

Type material.

Holotype: ♂, has the following two rectangular labels: white printed - || USA: TEXAS: Cameron Co. | E of Brownsville, ex ovum | ex ♀ collected 18-Jan-2003 | ecl. 12-Mar-2003 Grishin N.V. ||; red printed - || HOLOTYPE ♂ | Hermeuptychia | hermybius Grishin ||. The holotype is illustrated in Figs 48-49. Upon publication, the holotype will be deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC (USNM). Paratypes: 55 ♂♂ and 45 ♀♀, from USA: Texas, unless indicated otherwise. Of these, 9 ♂♂ and 12 ♀♀ are siblings of the holotype read from ova, with the same data, their sexes, eclosion dates and GenBank accessions|DNA voucher numbers|genitalia codes (where available, and in this format for other paratypes) are: 1 ♀ 8-Mar-2003; 1 ♂ 9-Mar-2003, KJ025572|NVG-1610|NVG131017-02 (Fig. 62b); 2 ♂♂ and 1 ♀ 9-Mar-2003; 1 ♂ and 1 ♀ 10-Mar-2003; 1 ♂ and 1 ♀ 11-Mar-2003; 3 ♂♂ 12-Mar-2003; 1 ♀ 14-Mar-2003, KJ025573|NVG-1611|NVG131017-03 (Fig. 64 s–t); 1 ♀ 15-Mar-2003; 1 ♀ 16-Mar-2003, KJ025574|NVG-1612|NVG131017-04 (Fig. 64 u–v); 1 ♀ 17-Mar-2003, KJ025569|NVG-1603|NVG130927-17 (Fig. 64 q–r); 2 ♀♀ 17-Mar-2003; 1 ♀ 21-Mar-2003; 1 ♂ 30-Mar-2003, KJ025571|NVG-1609|NVG131017-01 (Fig. 62a); 1 ♀ 2-Apr-2003 (Figs 50-51). Other paratypes are: 1 ♂ ibid., collected on wing 18-Jan-2003, KJ025570|NVG-1607|NVG130927-18 (Figs 54-55, 60b, e, h, k). 1 ♀ Cameron Co., E of Brownsville, 19-Oct-1997, leg. N. V. Grishin, KJ025575|NVG-1628|NVG131017-05. 1 ♂ Cameron Co., Brownsville, {10-13}-Mar-1979, leg. T. Friedlander, NVG140104-01 [TAMU] (Fig. 62c). 1 ♂ (06-Jun-2007) 1 ♀ (07-Jun-2007) Cameron Co., Los Fresnos, Ted Hunt & Loop Rd., leg. William R. Dempwolf. 4 ♀♀ Hidalgo Co., 1.5 air mi SE of Relampago, Rio Rico Rd., 26.07, -97.891, 21 m, 13-Jun-2013, leg. W. R. Dempwolf; 2 ♂♂ ibid., 19-Oct-2013, KJ025577|NVG-1698|NVG131229-04 (Fig. 62d) and KJ025578|NVG-1699|NVG131229-05 (Figs 56, 62e); 1 ♀ ibid., 19-Oct-2013, KJ025576|NVG-1695|NVG131229-03 (Fig. 64 w–x); 3 ♂♂ 4 ♀♀ ibid., 19-Oct-2013; 2 ♂♂ 4 ♀♀ ibid., 21-Oct-2013; 3 ♂♂ ibid., 24-Oct-2013. 1 ♀ TX: Starr Co., Rio Grande City, Fort Ringgold, 26.3707, -98.8064, 45 m, 12-Nov-2010, leg. W. R. Dempwolf; 1 ♀ ibid., 13-Jun-2013; 1 ♂ ibid., 20-Oct-2013, KJ025580|NVG-1714|NVG131229-07 (Fig. 62f); 1 ♀ ibid., 20-Oct-2013, KJ025579|NVG-1712|NVG131229-06; 2 ♂♂ ibid., 20-Oct-2013; 1 ♂ ibid., 23-Oct-2013; 2 ♂♂ 1 ♀ ibid., 9-Nov-2013. 2 ♂♂ Starr Co., Roma, S of Roma International Bridge, 26.4035, -99.0175, 50 m, 20-Oct-2013, leg. W. R. Dempwolf, KJ025581|NVG-1726|NVG131229-08 (Fig. 62g) and KJ025582|NVG-1727|NVG131229-09 (Fig. 62h); 8 ♂♂ 7 ♀♀ ibid., 20-Oct-2013. 1 ♀ Starr Co., Roma Creek, Hwy 650/Hwy 83, 29-Oct-2007, leg. W. R. Dempwolf. 2 ♀♀ Starr Co., 0.5 mi S of Fronton, 26.399, -99.085, 50 m, 20-Oct-2013, leg. W. R. Dempwolf, KJ025583|NVG-1735|NVG131229-10 and KJ025584|NVG-1737|NVG131229-11 (Figs 57, 64 y–z); 7 ♂♂ 3 ♀♀ ibid., 20-Oct-2013. 1 ♂ Starr Co., Salineno @ Rio Grande, 26.51463, -99.11633, 53 m, 23-Oct-2013, leg. W. R. Dempwolf, KJ025585|NVG-1747|NVG131229-12 (Fig. 62i). 1 ♂ Zapata Co., San Ygnacio @ Rio Grande, 92 m, 7-Oct-2007, leg. N. V. Grishin, KJ025586|NVG-1635|NVG131017-12 (Figs 52, 61b, 62j). 1 ♂ Webb Co., Laredo, 15-Apr-1949, leg. E. L. Todd KJ025587|13385H10|NVG131102-53 [USNM] (Figs 53, 62k). 1 ♂ Mexico: Tamaulipas: Rt. 101 at Rio Corona, 1-Jan-1980, leg. P. W. Kovarik & D. S. Bogar, NVG140104-04 [TAMU]. 1 ♂ Mexico: Tamaulipas: El Canindo, nr. Ejido San José, 7.5 km W Gómez Farías, 1400 m, {19-21}-Jul-1994, leg. C. Cate & T. Riley, NVG140104-67 [TAMU]. 2 ♂♂ Mexico: Tamaulipas: Ciudad Mante, Los Arcos Ct., 19-Dec-1973, leg. R. O. & C. A. Kendall, NVG140104-22 and NVG130104-23 [TAMU] (Figs 58, 62m); 1 ♂ ibid., 28-Jan-1995, ex larva, foodplant Panicum maximus Jacq., NVG140104-24 [TAMU]. 1 ♂ Mexico: Tamaulipas: Quintero cave [22.6333, -99.0333], 7-Jan-1974, leg. R. O. & C. A. Kendall, NVG130104-24 [TAMU] (Figs 59, 62l). 1 ♂ 1 ♀ Mexico: San Luis Potosí: El Salto Falls, 30-Dec-1979, leg. P. W. Kovarik & D. S. Bogar, NVG140104-03 and NVG140104-02 [TAMU].

Type locality.

USA: Texas: Cameron County, east of Brownsville. It is a shaded area covered in Guinea grass ( Panicum maximus ), situated near a ravine and overgrown with taller trees.

Etymology.

The name is a fusion of two words: herm[es] beginning and [sos]ybius ending. It symbolizes that this species traditionally and previously regarded as Hermeuptychia hermes is phylogenetically closer to Hermeuptychia sosybius , and yet is distinct from it. The resulting word is unique and currently unknown to internet search engines, which is expected to ease its searches. The name is a noun in apposition.

Distribution.

This species is currently recorded from the lower Rio Grande Valley region of Texas along the Rio Grande from Laredo to the Gulf coast (Webb, Za pata, Starr, Hidalgo, and Cameron Counties, Fig. 67) and in neighboring Mexico (Tamaulipas, San Luis Potosí).

Diagnosis.

In wing pattern, the new species is most similar to Hermeuptychia sosybius , but typically can be differentiated from it by: (a) eyespots that are not only smaller, but also more uniform in size, i.e. out of 5 forewing eyespots, 4 (except the one near costa) are usually about the same size, and the eyespot that is black-ringed in most specimens (second from costa) is typically not the largest (this eyespot is frequently the largest in Hermeuptychia sosybius ), but the next-to-last eyespot (4th from the costa) is usually the largest one; (b) more undulate postmedial line on ventral hindwing, that frequently strongly bulges basad by the largest eyespot near apex (in cell M1-M2); (c) more undulate submarginal sinuous line, which on ventral hindwing barely touches the largest eyespot near the tornus (in cell Cu1-Cu2, second eyespot from tornus, indicated in Fig. 57)-this line is usually fully merged with this eyespot border for some distance in Hermeuptychia sosybius . Wing-based identification is not absolute due to extensive pattern variation in both species.

In male genitalia, the new species is also closest to Hermeuptychia sosybius and should be attributed to the same morphogroup 4 of Seraphim et al. (2014). It differs from Hermeuptychia sosybius in the following trends (Figs 60-61): (1) uncus is less convex and narrower on the sides in dorsal (or ventral) view, with a broader truncated apex, the width at the apex is usually more than 2/3 of the width at the narrowest point near the base (Figs 60b, e, 61b); (2) valva is typically “higher” in lateral view (dorso-ventral direction), more square at the base (Fig. 60k) and is less extended (Fig. 60h); (3) aedeagus is somewhat broader and is frequently bent near its middle, with a medium length phallobase (Fig. 60e); (4) usually more obtuse angle formed by the tegumen and vinculum in lateral view (Fig. 60k). These characters are quite subtle, and as illustrated in Fig. 62 (compare panels a–m with panels o–z 2) are subject to significant variation. In contrast, distinction of Hermeuptychia intricata (Fig. 62n for comparison) is always definitive and clear-cut. To evaluate the confidence of Hermeuptychia hermybius identification by male genitalia and to test the ability to differentiate this new species from Hermeuptychia sosybius by objective criteria, we resorted to morphometric analysis (Fig. 63). For simplicity, we have chosen to exploit only two trends listed above: (1) shape of uncus in dorsal view and (2) shape of valva base in lateral view. The shape of uncus was measured by the ratio of width at the apex (a) to the width at the narrowest point near the base (b), and by the ratio of the distance from apex to the widest point in cross-section (c) to the distance from apex to the narrowest point near the base (d). We noticed that both of these ratios tend to be smaller in Hermeuptychia sosybius . Instead of applying PCA or other similar data-driven technique, which may be biased by the data at hand (i.e. the resulting transformation would change with the dataset used), we combined these measurements in a data-independent transformation. We used a weighted sum of the two ratios, with the weight of the second ratio arbitrarily set to half the weight of the first one: a/b+0.5c/d, since the ratio of widths (first ratio) seemed to tell the species apart better than the ratio of lengths (second ratio). The shape of the valva base in lateral view was quantified by the ratio of length of the dorsal “window” (less sclerotized, membranous and flat segment along dorsal side near the base) to the height of the valva at the distal end of the “window”. These variables were measured and computed on a diverse sample of 27 genitalia illustrated in Fig. 62. The resulting plot (Fig. 63 on the right) separated the two species. Therefore these simple measurements could be used to tell between these two cryptic Hermeuptychia species by male genitalia. However, we were not able to find characters in female genitalia to differentiate the new species from Hermeuptychia sosybius .

Finally, the most confident identification is provided by DNA barcode sequences (Fig. 66) that show little variation within each species (most sequences are identical across the range, maximum difference below 1% in Hermeuptychia sosybius ), but reveal a definitive 2% hiatus between central and south Texas populations (Figs 66-67). We selected all positions that were invariant in the barcode sample of each species but different between the two species as characters to differentiate Hermeuptychia hermybius from Hermeuptychia sosybius . The resulting 11 positions are listed in the format "k X (not Y)", where k is a sequential number of the position (numbering is from 1 to 658 for the barcode sequence shown above as a reference), X is a nucleotide in Hermeuptychia hermybius barcodes and Y is a nucleotide in Hermeuptychia sosybius barcodes: 64 T (not C), 73 G (not A), 82 T (not C), 118 C (not T), 133 C (not T), 235 C (not T), 238 A (not G), 364 C (not T), 436 C (not T), 526 A (not T), 616 C (not T). These positions distinguish the two species; however, some of the positions are expected to show variation when a larger sample of sequence is accumulated.

Life history.

The holotype of the new species, along with 21 paratypes are specimen reared in the lab from ova obtained from a captive female. All life history stages are illustrated in Fig. 70, and could be compared to the images of Hermeuptychia sosybius life history (Fig. 69). Immature stages of both species are very similar and without larger sample it is difficult to derive solid conclusions about the differences. Nevertheless, the following observations were made. Natural foodplants seems to be Panicum maximus (Guinea grass) per R. O. Kendall & C. A. Kendall, who reared caterpillars found on this grass in Mexico: Tamaulipas [TAMU collection]. This plant is also common in the lower Rio Grande Valley and is ubiquitously present where Hermeuptychia adults were encountered. Caterpillars hatched from eggs in captivity readily accepted Cynodon dactylon (L.) Pers. (Bermuda grass) and were successfully reared on it. Both Hermeuptychia sosybius and Hermeuptychia hermybius caterpillars go through four instars prior to pupation, and the first instar has black head capsule (Figs 69 b–d, 70 b–c). In subsequent instars, head capsule is green and round, without horns and projections (Figs 69 e–m, 70 d–m). Caterpillars of both species typically rest below leaves on loosely made silk pads, frequently in pairs, when two caterpillars face each other “head-to-head” (Figs 69h, 70c). When disturbed, caterpillars first curl into a C head-to-tail while legs being attached to the leaf (Figs 69f, j, 70e), then to a full O, head-to-legs (Fig. 70g). White dorsolateral spots in ultimate instar seem to be more pronounced in Hermeuptychia hermybius than in Hermeuptychia sosybius (compare Fig. 70 g–k with 69k). Pupae of Hermeuptychia hermybius were stronger patterned with brown on the sides (Fig. 70o) than those of Hermeuptychia sosybius from two distant-from-each-other Texas localities (Fig. 69 n–o), and some Hermeuptychia hermybius pupae were brown in color (Fig. 70n).