Catharylla bijuga T. Leger & B. Landry

Leger, Theo, Landry, Bernard, Nuss, Matthias & Mally, Richard, 2014, Systematics of the Neotropical genus Catharylla Zeller (Lepidoptera, Pyralidae s. l., Crambinae), ZooKeys 375, pp. 15-73 : 23-26

Catharylla bijuga T. Leger & B. Landry sp. n. Figs 1, 11, 12, 34, 45

Type material.

Holotype. ♂, with labels as follows: "Pied Saut, | Oyapok [sic] River, | French Guiana, | S. M. Klages | C. M. Acc. 6111."; "Dec[ember]. | 1917"; "HOLOTYPE | Catharylla bijuga | T. Léger & B. Landry" [red label]; "Catharylla | ramona sp. n. | det. Bleszynski, 1969"; "MANUSCRIPT | NAME" [white card with red lettering and thin red rectangle submarginally]; "BL 1744 ♂". Deposited in CMNH.

Paratypes. 16 ♂, 9 ♀. BRAZIL: 1 ♂ (genitalia on slide BL 1748, used for DNA Barcoding BC MTD 01840), Amazonas, P[ar]q.[ue] Nac.[ional] do Jaú, Rio Jaú, bg. Miratucú, 1°57'S, / 61°49'W, 26-27.vii.1995, U[ltra] V[iolet] light sheet (R. W. Hutchings) (USNM). FRENCH GUIANA: 2 ♂ (1 with genitalia on slide Pyralidae Brit. Mus. slide N°15893) with same data as holotype (BMNH); 5 ♂, 1 ♀ (2 ♂ with genitalia on slides Pyralidae Brit. Mus. Slide N°15891, N°15892, ♀ with genitalia on slide BL 1735) with same locality as holotype except i.1918 (1 ♂), ii.1918 (4 ♂, 1 ♀) (S. M. Klages) (BMNH, CMNH); 1 ♂, 2 ♀, Parcelles CIRAD de Combi, plantations expérimentales pk 1.5, 5°18'N, 52°55'30 W, 4.iii.2011, piège lumineux [light trap] (B. Hermier) (♂ with Hermier n° 24340, 2 ♀ with labels Hermier n° 24341 & 24345) (MHNG); 3 ♂, 2 ♀ (2 ♂ with genitalia on slides BL 1719 and Pyralidae Brit. Mus. Slide N° 7815, 2 ♀ with genitalia on slides BL 1739 and BL 1740), Saint-Jean-du-Maroni (Le Moult) (BMNH); 1 ♂, Saint-Laurent-du-Maroni (USNM); 1 ♂ (genitalia on slide BL 1694, (used for DNA barcoding BC MTD 01839) Roura, 3.6km E[ast] Roura at r[oa]d to Crique Gabrielle, 50m, 20.iv.1994, at light (J. S. Miller & C. Snyder) (AMNH); 1 ♀ (genitalia on slide BL 1734), Cayenne, iii.1917 (CMNH). GUYANA: 1 ♂, New River 1938 (C.A. Hudson) (BMNH); 1 ♂, Mallali [sic] (USNM). SURINAME: 1 ♀ (genitalia on slide USNM 52888), Geldersland, Surinam River (USNM); 1 ♀ (genitalia on slide BL 1732), Sipaliwini Distr[ict], Thibiti area, Kabo Creek, partly swampy, primary forest on hilly slopes, ca. 2km from river, 29.v.1989 (J. Beerlink) (Schouten Coll.).

COI barcode sequence of paratype BC MTD 01839 (654 bp): ACATTATATTTTATCTTCGGAATTTGAGCAGGAATAGTTGGAACATCCCTAAGACTTTTAATTCGAGCAGAATTAGGTAATCCAGGTTCTCTTATTGGTGACGACCAAATTTATAATACTATTGTTACTGCTCATGCATTTATTATAATTTTTTTTATAGTTATGCCAATTATAATTGGAGGATTCGGTAATTGATTAGTTCCATTAATATTGGGAGCACCAGATATAGCATTCCCACGAATAAATAATATAAGATTTTGATTACTCCCCCCCTCTTTAATCCTATTAATTTCTAGAAGAGTTGTAGAAAATGGAGCTGGAACAGGATGAACAGTTTACCCCCCACTTTCATCAAATATTGCTCATAGTGGTAGATCTGTAGATTTAGCAATTTTTTCTCTACACTTAGCAGGAATTTCATCAATCTTAGGAGCTATTAATTTTATTACAACAATTCTTAATATACGAATTAATGGTTTATCTTTCGATCAAATACCTTTATTTGTTTGATCTGTAGGAATTACAGCTTTACTTCTTCTCTTATCCTTACCCGTATTAGCTGGTGCTATTACTATACTTTTAACTGATCGAAATTTAAATACATCTTTTTTTGATCCTGCTGGAGGAGGAGATCCTATCCTTTACCAACACTTA

Diagnosis.

On the forewing (Fig. 1), the seven, thin, marginal dark brown dashes with the most tornal two shaped like spots will separate this species from the others. In male genitalia (Fig. 11), the strongly sclerotized double costal arm of the valva with the ventral arm tubular is a distinctive character. In female genitalia, the best diagnostic character is the sclerotized projection latero-ventrally on sternite VIII (Fig. 34).

Description.

Male (n = 17) (Fig. 1): Antenna brown with light ochreous scales; with patch of dark brown scales at base. Maxillary palpus ringed with brown at base and half of length, white tipped. Labial palpus: 1.4-1.6 mm long; ochreous, slightly lighter basally, ringed with dark brown at 2/3, white tipped. Thorax slightly ochreous at collar. Foreleg coxa white; femur ochreous, dark brown dorsally; tibia and tarsomeres ochreous, distally ringed with brown. Midleg and hindleg light ochreous; tibia-femur joint brown on midleg; tarsomeres II–V brown to dark brown on upperside, with white ringed tips. Abdomen dull white to greyish brown. Forewing length: 9.0-10.5 mm; snow white, with yellow ochreous to brown costal margin, partially disrupted when meeting transverse lines; median line yellow ochreous; subterminal line yellow ochreous to brown, forming small triangular spot on costal margin; subapical triangle on costal margin ochreous; outer margin slightly ochreous with five dark brown dashes regularly spaced or sometimes forming faintly continuous line, and one cubital and one anal spots, with cubital spot slightly displaced toward base; fringes brass colored; underside dull white to light ochreous along costal margin, with marginal dashes pronounced. Hindwing snow white, veins slightly ochreous, with shiny aspect; marginal line thin, brown, pronounced up to CuA1, then shiny white; fringes white; underside white, with same margin as on recto.

Tympanal organs (n = 8): Tympanic pockets extending slightly beyond transverse ridge, rounded. Tympanic drum elongate, more or less oval, postero-laterally extended beyond transverse ridge.

Male genitalia (n = 8) (Figs 11, 12): Uncus slightly down-curved, about 3/5 length of tegumen arms, with few setae laterally; tip pointed; uncus arms not separated at base, forming low bump medio-ventrally. Gnathos arms joining at half their length; distal half with short, rounded, dorsal projection at base; directed upward subapically at about 50° angle; slightly shorter than uncus and thinner. Tegumen pedunculi progressively widening toward uncus; dorsal connection of tegumen about 1/3 length of pedunculi; ventral margin straight; dorsal margin slightly convex, bare. Cucculus moderately wide, narrowing in distal 1/4; costal arm of valva double, bare, about as long as cucculus, joined to cucculus until 3/5 of its length; ventral arm thin, tubular, strongly sclerotized, slightly curved inward, apex directed upward, narrowed, pointed; dorsal arm broader, slightly shorter than ventral arm, straight, apically rounded, less thickly sclerotized than ventral arm. Vinculum enlarging latero-dorsally, ventrally narrow; saccus short, rounded. Juxta triangular, apically broadly rounded, slightly curved downward, basally projected into two large lateral lobes. Phallus almost straight, with slightly upturned sclerotized apex; vesica covered with microspicules barely visible, with one large, curved, pointed cornutus.

Female (n = 10): Labial palpi: 1.1-1.4 mm long. Forewing length: 11-15 mm; frenulum triple.

Female genitalia (n = 6) (Fig. 34): Papillae anales slightly projected ventrally and dorsally, dorsally forming prominent sclerotized rounded bulge. Posterior apophyses widened basally, 0.35-0.5 × length of papillae anales. Segment VIII circular in cross section, enlarging progressively toward papillae. Tergite VIII narrow, about 2/5 length of sternite VIII, with short setae along posterior edge. Anterior apophyses wide at base, about 0.1 × length of papillae. Sterigma with thin slightly sclerotized membrane covered with minute spicules dorsad of ostium bursae, with posterior margin slightly indented; with sclerotized projection laterad from sternite VIII antero-ventrally, with tip bifid, longer part directed downward, shorter part lateral, curved posterad. Basal part of ductus bursae ventrally sclerotized, looping and narrow, progressively widening toward corpus bursae. Corpus bursae poorly differenciated from ductus, twice as long as wide, without signum.

Distribution.

The species occurs in lowlands in the three Guianas and Brazil (Fig. 45).

Etymology.

Bijuga comes from the Latin bijugus, a, um which means "yoked together, double", in reference to the bifid costal arm of the male genitalia.

Notes.

In some paratypes from French Guiana the collecting data mention a “pk” (="point kilométrique”). This kilometric marker refers to the distance of the collecting spot on the forest road to the nearest main road. CIRAD (Centre de coopération internationale en recherche agronomique pour le développement) refers to the name of the research institution leading agronomical research on the Combi site. the Combi site. When S. Bleszynski looked into Catharylla , he gave the manuscript name Catharylla ramona to this species, but never published it. The comparison of the tip of the tubular costal arm of the male genitalia and the female lateral projections of sternite VIII shows rather nicely that the male hooks the female genitalia during the mating process. The specimen collected in Parque Nacional do Jaú, Brazil, shows a divergence in COI barcode sequence of 5.05% with that of Roura, French Guiana. In morphology we find no significant difference corroborating this divergence. The relationships of this species to the others remain uncertain in our phylogenetic analyses.