Sabera kolbei ( Ribbe, 1899 ), 2024
|
publication ID |
2643-4806 |
|
persistent identifier |
https://treatment.plazi.org/id/E87A9B1F-9A57-852C-FEDC-2B9260A19180 |
|
treatment provided by |
Felipe |
|
scientific name |
Sabera kolbei ( Ribbe, 1899 ) |
| status |
|
Telicota kolbei Ribbe, 1899 View in CoL belongs to the genus Sabera Swinhoe, 1908 and not Mimene Joicey & Talbot, 1917
Genomic analysis of a syntype of Telicota kolbei Ribbe, 1899 (type locality in New Britain, sequenced as NVG-22016H05) reveals that it is not monophyletic with Mimene Joicey & Talbot, 1917 (type species Ismene miltias Kirsch, 1877 ), the genus of its current placement, but instead is sister to Sabera Swinhoe, 1908 (type species Hesperia caesina Hewitson, 1866 ), which is a sister genus of Mimene ( Fig. 44). Therefore, T. kolbei does not belong to Mimene , and we transfer it to Sabera forming Sabera kolbei ( Ribbe, 1899) , comb. nov.
Furthermore, to stabilize nomenclature and define the name T. kolbei objectively, N.V.G. hereby designates a sequenced syntype in ZSMC ( Fig. 47a), female that, according to its label, was illustrated in the original description by Ribbe (1899) and bears the following six rectangular labels (2nd, 3rd, and 5th handwritten, others printed; 2nd green, 4th purple, others white): [Neu Pommern | Kinigunang | C. Ribbe], [abgebildet], [Kolbei | Ribbe | abgebild.], [Original], [ ♀ Cerone Kolbei Rib. | typ. | N. Pommern], [DNA sample ID: | NVG-22016H05 | c/o Nick V. Grishin ] as the lectotype of Telicota kolbei Ribbe, 1899 . The lectotype has a tear near the base of the forewing costa, is missing the right antenna, and its left antenna is wide-S shaped. The COI barcode sequence of the lectotype, sample NVG-22016H05, GenBank PQ489713, 658 base pairs is: AACTTTATATTTTATTTTTGGTATTTGATCAGGAATATTAGGAACTTCCTTAAGTCTATTAATTCGTACCGAATTGGGTAACCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATCGTAACTGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAATTCCCTTAATACTAGGAGCCCCTGATATAGCTTTCCCACGAA TAAATAATATAAGATTTTGAATATTACCCCCTTCTTTAACACTTTTAATTTCTAGAAGAATTGTAGAAAACGGTGCCGGAACTGGTTGAACTGTTTACCCCCCTCTTTCTTCTAATATTGC TCATCAAGGTTCCTCTGTTGATTTAGCAATCTTTTCTTTACATTTAGCTGGAATTTCATCAATTTTAGGAGCTATTAATTTTATTACCACAATTATTAATATACGAATTAACAATTTATCA TTTGATCAAATACCTCTATTTATTTGATCTGTAGGAATTACAGCATTATTATTATTAATTTCATTACCAGTCTTAGCAGGAGCTATTACCATATTATTAACTGATCGAAATTTAAATACTT CATTTTTCGACCCTGCAGGAGGAGGTGATCCTATTTTATATCAACATTTATTT
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
|
Kingdom |
|
|
Phylum |
|
|
Class |
|
|
Order |
|
|
Family |
|
|
Genus |
