Venanus randallgarciai Fernandez-Triana & Whitfield, 1981

Fernandez-Triana, Jose L, Whitfield, James B, Smith, M. Alex, Hallwachs, Winnie & Janzen, Daniel H., 2014, First record of the genus Venanus (Hymenoptera: Braconidae: Microgastrinae) in Mesoamerica, with the description of two new species from Costa Rica, Biodiversity Data Journal 2, pp. 4167-4167 : 4167

publication ID

https://dx.doi.org/10.3897/BDJ.2.e4167

persistent identifier

https://treatment.plazi.org/id/DD14F824-79D3-C9A0-C8A7-0D7DE380A845

treatment provided by

Biodiversity Data Journal by Pensoft (2019-03-21 00:03:52)

scientific name

Venanus randallgarciai Fernandez-Triana & Whitfield
status

sp. n.

Venanus randallgarciai Fernandez-Triana & Whitfield   ZBK sp. n.

Materials

Type status: Holotype. Occurrence: catalogNumber: CNCHYM 07223 ; recordedBy: J. Helava; individualID: CNCHYM 07223; individualCount: 1; sex: female; lifeStage: adult; Taxon: scientificName: Venanusrandallgarciai; phylum: Arthropoda; class: Insecta; order: Hymenoptera; family: Braconidae; genus: Venanus; specificEpithet: randallgarciai; scientificNameAuthorship: Fernández-Triana; Location: continent: Central America; country: Costa Rica; stateProvince: Alajuela; locality: 500 m North of Colonia Virgen del Socorro, Area de Conservacion Cordillera Volcanica Central ; verbatimElevation: 1400 m; verbatimLatitude: 10° 17' N; verbatimLongitude: 84° 10' W; verbatimCoordinateSystem: Degree, minutes; Identification: dateIdentified: 2014; Event: verbatimEventDate: 30-v-1973; Record Level: language: en; collectionCode: Insects; ownerInstitutionCode: CNC; basisOfRecord: PreservedSpecimen GoogleMaps

Description

Female. Body length: 2.2 mm. Fore wing length: 2.2 mm. Flagellomere 2 length/width: 0.11 mm/0.06 mm. Flagellomere 14: missing. Oculo-ocellar distance: 0.15 mm. Distance between posterior ocelli: 0.08 mm. Diameter of posterior ocellus: 0.05 mm. Metafemur length/width: 0.53 mm/0.18 mm. Metatibia length: 0.66 mm. Mediotergite 1 length/maximum width/minimum width: 0.30/0.15/0.09 mm. Mediotergite 2 length/width at posterior margin: 0.12/0.10 mm. Figs 3, 4.

Male. Unknown.

Diagnosis

The mediotergite 1 is relatively long and with a slight constriction near anterior end (Fig. 4). That character is also shared with other three species of Venanus . However, V. johnnyrosalesi can be separated from V. helavai by its much smaller size (2.2 mm vs 2.8-3.0 mm) and less sculptured propodeum, from V. yanayacuensis by its wider discal cell in fore wing (1.0 × vs 1.2 × as wide as high), metasoma color (brown vs black) and fore wing vein 2RS significanly longer than vein r (shorter than r in yanayacuensis ), and from V. johnnyrosalesi by proportion of veins 2RS and r (2.0 × vs 1.4 ×), sculpture of metapleuron and mediotergite 2, and narrower mediotergite 1 (narrowest width 0.6 × width at posterior margin vs 0.8 × in johnnyrosalesi ).

Etymology

Venanus randallgarciai is named in honor of Sr. Randall Garcia, currently of San Jose, Costa Rica, but also the first director of ACG and the current Executive Director of the Instituto Nacional de Biodiversidad (INBio), and therefore a major facilitator of ACG biodiversity inventory.

Distribution

Only known from a single locality in Area de Conservación Cordillera Volcanica Central, Alajuela, Costa Rica.

Notes

We obtained a partial sequence (164 bp) of the DNA barcoding region for the holotype (see also Suppl. material 1). It has the sequence accesion HYCNF533-11 in BOLD (www.boldsystems.org), and the nucleotide sequence is reproduced below:

TTATACCAATTATAATTGGAGGATTTGGAAATTGATTGGTGCCATTAATATTAGGGACTCCAGATATAGCTTTCCCTCGTATAAATAATATAAGATTTTGATTACTTATTCCTTCATTAT TTATATTAATTTTAAGAAGATTCATTAATACAGGCGCAGGTACG

Kingdom

Animalia

Phylum

Arthropoda

Class

Insecta

Order

Hymenoptera

Family

Braconidae

Genus

Venanus