Erythia paracheles, Zhang & Cong & Shen & Song & Grishin, 2023

Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina & Grishin, Nick V., 2023, Genomic analysis reveals new species and subspecies of butterflies, The Taxonomic Report of the International Lepidoptera Survey 11 (6), pp. 1-63 : 14-15

Erythia paracheles Grishin, new species

http://zoobank.org/ E7E4D9E8-760B-4D0F-BFC7-DD0060AC7FBB ( Figs. 12, 13 part)

Definition and diagnosis. Genomic analysis reveals that an orange female from central Panama ( Figs. 12, 13 orange) initially identified as an aberration of Erythia aurantiaca (Salvin & Godman, 1868) (type locality in Guatemala) is instead sister to but genetically differentiated from Erythia cheles (Godman & Salvin, 1889) (type locality in Panama: Chiriquí, holotype sequenced as NVG-21123B03) ( Fig. 13), e.g., COI barcode difference of 4.4% (29 bp). We sequenced two specimens of E. cheles (the holotype and another female, NVG-19036F06), and they are genetically close to each other ( Fig. 13 blue). However, due to strong genetic differentiation, the orange female represents a distinct species that, according to our investigation, does not have a name. The female of this new species differs from its relatives in the nearly uniform orange coloration of the dorsal side of wings, only with a hint of the brown outer margin, more developed by the apex of the forewing, and is similarly orange, only slightly yellower, on the ventral side, with a thin postdiscal darker orange band on both wings and no other markings. In females of other species, the apex of the dorsal forewing and usually the outer margin are largely brown, and there are at least traces of black submarginal spots on the ventral hindwing. While it remains unclear whether this specimen is an aberration, we are confident that it is a species distinct from both E. cheles and E. aurantiaca due to its prominent genetic differentiation, and, therefore, it is described as a new species. To confidently identify this new species despite the unknown phenotypic variation, we provide a diagnostic combination of DNA characters in the nuclear genome: cne11073.6.7: T54 C, cne3970.3.2: T111 C, cne20880. 1.4:A84G, cne10214.9.8:A66G, cne4577.3.8:C18T, cne 1935.4.1:C1113C (not T), cne 1935.4.1:C1558C (not A), cne84.2.2:C1860C (not T), cne15258.2.1:A612A (not T), cne14561.1.14:C79C (not T) and in the COI barcode : T16 C, 88C, T142 C, T169 C, T250 C, T361 C, T391 A, T400 C, A577G, T619 C.

Barcode sequence of the holotype. Sample NVG-19036F07, GenBank OR837726, 658 base pairs: AACTTTATATTTTATCTTTGGAATTTGAGCAGGAATAGTAGGAACATCATTAAGACTATTAATTCGAATAGAATTAGGAATTTCAGGCTCTTTTATTGGAGATGATCAAATTTATAATACT ATTGTAACAGCTCATGCTTTCATTATAATTTTTTTTATAGTAATACCCATTATAATCGGAGGATTTGGAAATTGACTAGTCCCCCTAATATTAGGAGCCCCTGATATAGCTTTTCCACGAA TAAATAACATAAGATTTTGATTATTACCCCCCTCATTAATACTTTTAATTTCAAGAAGAATTGTCGAAAACGGAGCAGGAACAGGATGAACTGTGTACCCCCCACTATCATCTAATATCGC TCACAGAGGATCATCAGTTGATTTAGCAATTTTTTCCTTACATTTAGCAGGAATTTCATCAATTTTAGGAGCTATTAACTTTATCACAACAATTATTAATATACGAGTAAATAATATAATA TTCGATCAAATATCCCTATTTATCTGAGCTGTTGGTATTACAGCTCTATTACTTTTACTATCATTACCAGTTTTAGCAGGAGCTATTACTATGCTATTAACTGATCGAAATTTAAATACAT CATTTTTTGATCCCGCTGGAGGAGGAGATCCAATTCTTTACCAACATTTATTT

Type material. Holotype: ♀ deposited in the National Museum of Natural History, Washington, DC, USA [ USNM], illustrated in Fig. 12, bears four printed labels: three white [ Riodinidae ? 3/28/76 | Las Cruces Trail, CZ], [DNA sample ID: | NVG-19036F07| c/o Nick V. Grishin ], [USNMENT | {QR Code} | 00939912], and one red [ HOLOTYPE ♀ | Erythia paracheles | Grishin ].

Type locality. Panama: Canal Zone , Las Cruces Trail .

Etymology. The prefix “para” means alongside, near, beyond, or similar to. This new species is sister to E. cheles and is similar to it. The name is treated as a masculine noun in apposition.

Distribution. Currently known only from the holotype collected in central Panama.