Erythia borrosa, Zhang & Cong & Shen & Song & Grishin, 2023
|
publication ID |
4594F1CA-9EE8-4A80-A0CA-792676139D20 |
|
publication LSID |
lsid:zoobank.org:pub:4594F1CA-9EE8-4A80-A0CA-792676139D20 |
|
persistent identifier |
https://treatment.plazi.org/id/D20187A3-027C-8C32-FDF0-FB4FFB29F998 |
|
treatment provided by |
Felipe |
|
scientific name |
Erythia borrosa |
| status |
new species |
Erythia borrosa Grishin, new species
http://zoobank.org/ 86B396F7-EF80-4EC8-AE29-A4D674DCDDDF
( Figs. 13 part, 14)
Definition and diagnosis. Genomic phylogeny inferred from all sequenced specimens of Euselasiini Kirby, 1871 (1867) reveals that a specimen from central Panama ( Figs. 13 magenta, 14) is sister to the clade of Erythia cheles (Godman & Salvin, 1889) ( type locality in Panama: Chiriquí) with Erythia paracheles sp. n. ( type locality in Panama: Canal Zone) and therefore represents a species distinct from them ( Fig. 13), also being strongly differentiated genetically, e.g., COI barcode difference of 4.9% (32 bp) from E. cheles and 5.9% (39 bp) from E. paracheles . These three species form a clade sister to Erythia aurantiaca (Salvin & Godman, 1868) ( type locality in Guatemala). Even in wing patterns, the specimen from Panama appears different from the named taxa, and these differences, supported by genetic differentiation, suggest that this specimen belongs to a new species. Males of this new species differ from their relatives in a diffuse boundary between brown framing along wing margins and orange interior on the dorsal side: brown overscaling partially extends into orange areas. The brown/orange boundary is sharper and could even be rather crips in closely related species, or orange areas are more restricted on forewing to the area between the inner margin and discal cell. The costal area of the dorsal hindwing is brown from its base, and the discal cell is largely orange but brown towards the costa; the dorsal hindwing has a brown batch at the apex and a brown margin of decreasing width and disappearing towards the tornus; the submarginal area is browner than the brighter orange discal area from costa to mid-wing. The ventral side of the wings is pearly-pinkish with a posdiscal pale-brown line on all wings (close to a submarginal row of spots on the hindwing) and orange-brown narrow marginal framing. Due to unexplored phenotypic variation, definitive identification is provided by DNA, and a combination of the following characters is diagnostic in the nuclear genome: cne5785.3.5:A96T, cne7688.1.2:T150G, cne3970. 3.2:G96A, cne254625.2.3:G270A, cne10780.4.1:T1347A, cne4782.4.3:T282T (not C), cne3195.11.14:A54A (not G), cne563.4.3:G216G (not A), cne563.4.3:G219G (not A), cne3970.3.2:T111T (not C) and in COI barcode: T4C, T56T, T197T, T202C, T206T, T274C, T550C.
Barcode sequence of the holotype. Sample NVG-19036H09, GenBank OR837727, 658 base pairs: AACCTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCATTAAGATTATTAATTCGAATAGAACTAGGAATTTCAGATTCTTTTATTGGAGATGATCAAATTTATAACACT ATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTCCCATTAATATTAGGAGCCCCTGATATAGCTTTTCCACGAA TAAATAATATAAGATTTTGATTATTACCCCCCTCATTAATTCTCTTAATTTCAAGAAGAATTGTTGAAAATGGAGCAGGAACAGGATGAACTGTGTACCCCCCACTATCATCTAATATTGC TCATAGAGGATCATCAGTTGATTTAGCTATTTTCTCTTTACATTTAGCAGGAATTTCATCAATTTTAGGAGCTATTAACTTTATTACAACAATTATTAATATACGAGTAAATAATATAATA TTTGATCAAATATCTCTATTTATTTGAGCTGTAGGAATTACAGCATTATTACTCTTATTATCATTACCAGTTTTAGCAGGAGCTATTACTATATTATTAACTGATCGAAATCTAAATACAT CATTTTTTGATCCTGCTGGAGGAGGAGATCCAATTCTTTATCAACATTTATTT
Type material. Holotype: ♂ deposited in the National Museum of Natural History , Washington, DC, USA [ USNM], illustrated in Fig. 14, bears four printed (2 nd and 3 rd lines on the 1 st label handwritten) labels: three white [ Panama: Panama | Cerro Campana | 800m. 17.III.1973 | G. B. Small], [DNA sample ID: | NVG-19036H09 | c/o Nick V. Grishin ], [USNMENT | { QR Code} | 01544858], and one red [ HOLOTYPE ♂ | Erythia borrosa | Grishin ].
Type locality. Panama: Panama Province, Cerro Campana , elevation 800 m.
Etymology. In Spanish, borrosa means blurry or fuzzy. The name refers to edges between brown and orange in this species that lack the sharpness of its relatives, and brown gradually dissolves into orange, or orange is overscaled with brown towards the margins. The name is a Latinized feminine adjective.
Distribution. Currently known only from the holotype collected in central Panama.
| USNM |
Smithsonian Institution, National Museum of Natural History |
| V |
Royal British Columbia Museum - Herbarium |
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
|
Kingdom |
|
|
Phylum |
|
|
Class |
|
|
Order |
|
|
Family |
|
|
Genus |
