Ochlodes napa kaibab, Zhang & Cong & Shen & Song & Grishin, 2023

Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina & Grishin, Nick V., 2023, Genomic analysis reveals new species and subspecies of butterflies, The Taxonomic Report of the International Lepidoptera Survey 11 (6), pp. 1-63 : 46-47

Ochlodes napa kaibab Grishin, new subspecies

http://zoobank.org/ 0CF5A2B5-E6B9-460A-999F-500EFEFE3921

( Figs. 48 part, 49)

Definition and diagnosis. Genomic sequencing reveals that specimens of Ochlodes napa (W. H. Edwards, 1865) , stat. rest. ( type locality in USA: Colorado, Clear Creek Co.) from the southwestern part of the range are genetically differentiated from the rest ( Fig. 48) with the COI barcode difference of 2.0% (13 bp). This difference is large because they possess mitochondrial genomes (and therefore COI barcodes) more similar to Ochlodes sylvanoides (Boisduval, 1852) ( type locality in USA: California, Plumas Co.) than to O. napa ( Fig. 48b). Due to this genetic differentiation, these populations from Coconino Co. in Arizona represent a distinct taxon that currently does not have a name and therefore is new. We consider it to be a subspecies of O. napa because genetic differentiation in the nuclear genome is not prominent ( Fig. 48a), and we are not aware of this new taxon being sympatric with O. napa . This new subspecies is characterized by a darker appearance, sharper edges of brown areas likely caused by reduced fulvous overscaling over the brown areas, especially near their edges (e.g., the brown spot distad of the discal cell on forewing), and submarginal spots in cells M 1 -M 2 and M 2 -M 3 are better separated from fulvous areas of the forewing. Its females tend to have more developed fulvous areas in the forewing provided by DNA, and a combination of the following characters is diagnostic in the nuclear genome: aly 1500.7.2:A162T, aly 1500.7.2:T170A, aly3598.15.2:G447A, aly3598.15.2:C459T, aly378.20.4:A390G and in COI barcode: A217A, A256C, T439C, T505C, T583T, T616C.

Barcode sequence of the holotype. Sample NVG-21113C07, GenBank OR837739, 658 base pairs: AACTTTATACTTTATTTTTGGTATTTGAGCAGGAATATTAGGAACTTCTTTAAGTTTATTAATTCGTACAGAATTAGGTAATCCAGGATCTTTAATTGGTGATGATCAAATTTATAATACT ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTTCCATTAATATTAGGAGCTCCTGATATAGCATTTCCTCGAA TAAATAATATAAGCTTTTGAATATTACCTCCTTCATTAACATTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACTGGTTGAACAGTATATCCTCCTTTATCTTCTAATATTGC TCACCAAGGATCTTCTGTTGATTTAGCAATTTTTTCTCTTCATTTAGCTGGTATTTCATCTATTCTAGGAGCTATCAATTTTATTACAACAATTATTAATATACGAATTAAAAACTTATCA TTTGATCAAATACCCTTATTCGTATGATCAGTAGGTATTACAGCATTATTATTATTATTATCTTTACCTGTCTTAGCAGGTGCTATTACAATATTACTTACTGATCGAAATTTAAATACTT CTTTTTTTGACCCAGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT

Type material. Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity, Florida Museum of Natural History, Gainesville, FL, USA [ MGCL], illustrated in Fig. 49a, bears four printed labels: three white [South Canyon Spring | Kaibab Plateau, AZ | 30 July 2021 | Robb Hannawacker], [Woodland Skipper | Ochlodes sylvanoides | male], [DNA sample ID: | NVG-21113C07 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ Ochlodes napa | kaibab Grishin ]. Paratype: 1♀ same data as the holotype (NVG-21113C06) ( Fig. 49b).

Type locality. USA: Arizona, Coconino Co., Kaibab Plateau, South Canyon Spring .

Etymology. The name is a noun in apposition taken from the type locality of this species.

Distribution. Northern Arizona, USA. Populations in southeastern Utah are the nominal subspecies, and those in southwestern Utah should be studied to determine their identity.