Cobalus vitellina Herrich-Schäffer, 1869

Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina & Grishin, Nick V., 2023, Genomic analysis reveals new species and subspecies of butterflies, The Taxonomic Report of the International Lepidoptera Survey 11 (6), pp. 1-63 : 52-54

Neotype designation for Cobalus vitellina Herrich-Schäffer, 1869

Cobalus vitellina Herrich-Schäffer, 1869 was described within the identification key from an unstated number of specimens without locality data ( Herrich-Schäffer 1869). The description was rather general and can apply to several species. Our translation from German of relevant segments assembled from the Herrich-Schäffer key is: “forewing cell 3 with a pale spot before its middle, discal cell unmarked; hindwing above with three yellow spots in cells 3–5, on the underside with a continuous yellow band.” Primary types for several names proposed in the same work are curated in MFNB. These types came from the Herrich-Schäffer collection (label “Coll. H.—Sch.”) through the Staudinger collection (label “Coll. Staudinger”) and frequently bear identification labels in Herrich-Schäffer handwriting. To confidently infer the taxonomic identity of C. vitellina , we searched for such specimens in MFNB that agreed with the original description. We were not able to find syntypes of C. vitellina and turned to additional resources, such as publications and specimens collected around the time of C. vitellina description identified as this species or agreeing with the original description.

According to Godman (1907), Plötz illustrated “nearly all” species described by Herrich-Schäffer. While these drawings are not located to this day, Godman found specimens in his collection that, in his opinion, matched each drawing closely and obtained drawing copies of species he could not identify (1907). While there is no certainty that Plötz illustrated Herrich-Schäffer syntypes and not some other specimens determined by him or by Herrich-Schäffer to be these species, we use Plötz’s (1883) description of C. vitellina , which he placed in the genus Hesperia Fabricius, 1793 (type species Papilio comma Linnaeus, 1758 ), to learn more about this taxon. Plötz’s description of his drawings (rather than actual specimens) is more detailed than Herrich-Schäffer’s and gives “ Mexico ” as the locality. We translate the description from German as: “Ventral side red-brown, forewing with basal half black, hindwing infused with rust-red, past the middle with a distorted rust-yellow band, which in cell 1c projects a ray towards the fringe. Dorsal side brown, forewing with deep red-yellow spots in cells 1–3 and 6–8; a small dot in cell 4. Hindwing with 3 yellow spots in cells 3–5 and yellow fringes. Antenna half as long as the forewing.” Both this description and Godman’s (1907) assessment, which noted that Plötz illustrated both a male and female from Mexico, agree with H. vitellina being either conspecific with or closely related to Lon melane (W. H. Edwards, 1869) (type locality in USA: California). Moreover, Draudt (1921 –1924) frequently used (inferior) copies of Plötz’s drawings as illustrations (Nakahara et al. 2022), and his figures of melane (plate 182e) might be copied from Plötz’s H. vitellina , which Draudt synonymized with L. melane . The dorsal side shows a female, which is either an atypical specimen or not this species (instead reminding of Buzyges rolla (Mabille, 1883)) because the spots in cells M 3 -CuA 1 and CuA 1 -CuA 2 are nearly aligned with each other (in Lon species, these two spots do not overlap in most specimens), unless this is an imperfection of the reproduction from the original. The ventral side is of a male and is identifiable as L. melane or its close relative.

Furthermore, we found two specimens of interest in MFNB. The first specimen (NVG-21116G04), from the Möschler collection collected in Mexico in 1876 and identified by Möschler as “ vitellina ”, agrees with all characters of this taxon presented above, except that the three spots on the dorsal hindwing are barely visible. This specimen cannot be a syntype because it was collected after the description of C. vitellina . The second specimen (NVG-22091C05) is from Herrich-Schäffer’s collection, also from Mexico, and bears the identification label “marmorosa HS” in Herrich-Schäffer’s handwriting. This specimen is one of those Godman (1900) mentioned within his treatment of “ Atrytone melane ” and identified as such. It is probably not a syntype of C. vitellina either because it possesses four (or even five), and not three, as per the original description, yellow spots on the dorsal hindwing. This is a boldly patterned specimen with a very wide ventral hindwing orange-yellow band occupying nearly a third of the wing area, and it is possible that Herrich-Schäffer viewed it as a new species that he planned to call “marmorosa”, a name that was never published. Nevertheless, both specimens (NVG-21116G04 and NVG-22091C05) fall within the current concept of “ Paratrytone melane vitellina ” as outlined by Evans (1955) and have not been questioned since (Mielke 2005).

Not finding syntypes, we proceeded with the neotype designation because there was an exceptional need to clarify both the taxonomic identity and the type locality of C. vitellina . Although the name has been consistently applied to the Mexican subspecies of L. melane , the potential for destabilization of nomenclature arises due to the existence of additional species in this group in Mexico and Central America (see below) unless the name C. vitellina is objectively defined by the neotype that also provides details about the type locality. A number of Hesperiidae species from Mexico described in the second half of the 19 th century were likely based on specimens from Oaxaca, possibly collected by Deppe in 1824–1829. Therefore, we selected a neotype from Oaxaca. Hereby, N.V. G. designates a specimen in USNM illustrated in Fig. 53 (DNA sample NVG-18115F05) as the neotype of Cobalus vitellina Herrich-Schäffer, 1869 . This neotype corroborates the current application of the name for a relative of L. melane from Mexico, as stated by Plötz (1883) and Godman (1907), supported by Evans (1955), and followed since in all literature (Mielke 2005).

This neotype satisfies all requirements set forth by the ICZN Article 75.3, namely: 75.3.1. It is designated to clarify the taxonomic identity of Cobalus vitellina Herrich-Schäffer, 1869 , which is necessary because additional species are present among its close relatives, and to define the type locality that was not stated in the original description; 75.3.2. The characters to differentiate this taxon from others were given in the original description ( Herrich-Schäffer 1869), further elaborated by Plötz (1883). We regard them as follows: forewing brown with orange yellow spots in cells R 3 -R 4, R 4 -R 5, R 5 -M 1, M 3 -CuA 1, CuA 1 -CuA 2, and CuA 2 -1A+2A, and a dot in cell M 2 -M 3, discal cell unmarked; forewing beneath with nearly black basal half; hindwing above brown with three yellow spots in cells M 1 -M 2, M 2 -M 3, and M 3 - CuA 1; hindwing beneath rust-colored with a continuous orange-yellow band; antenna about half of the forewing in length; 75.3.3. The neotype specimen is a male bearing three labels: [ MEXICO: OAXACA | c. 3 mi. E La | Trinidad, 8500 ft | 3-VIII-1992 | J. Kemner], [DNA sample ID: | NVG-18115F05 | c/o Nick V. Grishin ], [USNMENT | {QR Code} | 01531599] and illustrated in Fig. 53; the neotype has a tear along SC vein from costa on the right forewing; 75.3.4. We carefully searched for syntypes of C. vitellina in the MFNB collection (see above) because most of the Herrich-Schäffer Hesperiidae types are in this collection, and a study by Häuser et al. (2003) did not locate the syntypes in Stuttgart. We also checked the ANSP collection, where several Herrich-Schäffer types of Caribbean taxa are curated. We failed to find syntypes of C. vitellina among Hesperiidae holdings in these collections and, therefore, believe that they were lost; 75.3.5. The neotype closely agrees with the original description of C. vitellina in all characters, as evidenced by comparing the neotype illustrated in Fig. 53 with the characters for this taxon given in the original description ( Herrich-Schäffer 1869) and listed above (75.3.2.); 75.3.6. The neotype is from Mexico: Oaxaca, ca. 3 mi E of La Trinidad, 8500 ft, and the type locality was not specified in the original description but was stated as “ Mexico ” by Plötz (1883); 75.3.7. The neotype is in

C. vitellina neotype, sample NVG-18115F05, GenBank OR837743, 658 base pairs, is: AACCTTATATTTTATTTTTGGTATTTGAGCAGGAATATTAGGAACTTCCTTAAGATTACTAATTCGTACAGAATTAGGTAATCCTGGATCTTTAATTGGAGATGATCAAATTTATAACACT ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTCATAGTTATACCTATTATAATCGGAGGATTTGGAAATTGATTAGTCCCATTAATATTAGGTGCCCCTGATATAGCTTTCCCCCGAA TAAATAATATAAGTTTTTGAATATTACCCCCCTCATTAACATTATTAATTTCAAGAAGAATTGTAGAAAATGGTGCAGGAACAGGTTGAACTGTTTACCCCCCCTTATCATCTAATATTGC ACACCAAGGCTCTTCTGTTGATTTAGCAATTTTTTCACTTCATTTAGCTGGAATTTCATCTATTTTAGGAGCTATTAACTTTATTACAACAATTATTAATATACGAATTAAAAATTTAATG TTTGATCAAATACCTTTATTCGTATGATCTGTAGGTATTACAGCCTTATTATTACTTTTATCTTTGCCTGTTTTAGCTGGAGCTATTACTATATTACTTACTGATCGAAATTTAAATACTT CATTTTTTGATCCAGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT