Lon chia, Zhang & Cong & Shen & Song & Grishin, 2023

Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina & Grishin, Nick V., 2023, Genomic analysis reveals new species and subspecies of butterflies, The Taxonomic Report of the International Lepidoptera Survey 11 (6), pp. 1-63 : 55-56

Lon chia Grishin, new species

http://zoobank.org/ E4498D7B-4A5E-4411-9CB0-E336AA04311F

( Figs. 54 part, 56)

Definition and diagnosis. The genomic tree reveals that specimens identified as Lon poa ( Evans, 1955) (type locality Costa Rica: Mount Poás), stat. nov. partition into two clades ( Fig. 54). One clade includes specimens from Costa Rica and Panama, being the true L. poa by locality and phenotype. The other clade is genetically differentiated from the first one with Fst/Gmin/COI barcode difference of 0.41/0.004/0.9% (6 bp) and represents a new species. This species keys to “ Paratrytone melane poa ” M.23.1(c) in Evans (1955) and is distinguished from the true L. poa by less extensive yellow overscaling on the ventral side of wings, in particular, on the hindwing; this overscaling is whiter, and the ground color in redder and browner than yellower. As a result, there is less contrast between the darker inner half and subapical half of the ventral forewing, which is paler in the apical half and contrasting dark brown towards the inner margin in L. poa . Definitive identification is provided by DNA, and a combination of the following characters is diagnostic in the nuclear genome: aly3177.11.6:A36C, aly3177.11.6:A39G, aly128.24.1: C189T, aly128.24.1:A235C, aly318.14.6:G672A and in COI barcode: T4C, T346C, T505C, A550A, 586T. Barcode sequence of the holotype. Sample NVG-22105H05, GenBank OR837745, 658 base pairs: AACCTTATATTTTATTTTTGGTATTTGAGCAGGAATATTAGGAACTTCCTTAAGATTATTAATTCGTACAGAATTAGGTAATCCTGGATCTTTAATTGGAGATGATCAAATTTATAACACT ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTCATAGTTATACCTATTATAATCGGAGGATTTGGAAATTGATTAGTCCCATTAATATTAGGTGCCCCTGATATAGCTTTCCCCCGAA TAAATAATATAAGTTTTTGAATATTACCCCCCTCATTAACATTATTAATTTCAAGAAGAATTGTAGAAAATGGTGCAGGAACAGGTTGAACTGTTTACCCCCCCTTATCATCTAATATTGC ACACCAAGGCTCTTCTGTTGATTTAGCAATTTTTTCACTTCATTTAGCTGGAATTTCATCTATTTTAGGAGCTATTAACTTTATTACAACAATTATTAATATACGAATTAAAAATTTAATG TTTGATCAAATACCTTTATTCGTATGATCTGTAGGTATTACAGCCTTATTATTACTTTTATCTTTACCTGTTTTAGCTGGAGCTATTACTATATTACTTACTGATCGAAATTTAAATACTT CATTTTTTGATCCAGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT

Type material. Holotype: ♂ deposited in the California Academy of Sciences, San Francisco, CA, USA [ CAS], illustrated in Fig. 56, bears five labels, the first two handwritten, others printed: four white [Rancho Belen, Chis. | Mex. IV-17-69 | Robert Wind], [ P. m. poa ], [DNA sample ID: | NVG-22105H05 | c/o Nick V. Grishin ], [{QR Code} CASENT | 8568431], and one red [ HOLOTYPE ♂ | Lon chia | Grishin ]. Paratypes: 5♂♂ 1♀: Mexico, Chiapas: 1♂ Comitan, Laguna Chamula, el. 7100 ft, 13-May-1987, C. J. Durden leg. (NVG-22056D01) [ TMMC]; San Cristobal, La Almolonga, ca. 7500 ft: 1♂ 3-May-1988, J. Kemner leg. (NVG-18115F06, USNMEND 01531600) [ USNM]; 1♂ 9-Jul-1988, C. J. Durden leg. (NVG-20062F09) [ TMMC]; 1♂ 5-Jul-1992, J. Kemner & A. Vasquez leg. (NVG-18115F08) [ USNM]; 1♂ Guatemala, Quiche department, above Chichicastenango, 11-Jan-1990, C. J. Durden leg. (NVG-22056C06) [ TMMC]; and 1♀ El Salvador, 2 mi down from Cerro Verde summit, 20-Aug-1972, G. F. & S. Hevel leg. (NVG-18115F09, USNMENT 01531603) [ USNM].

Type locality. Mexico: Chiapas, ca. 20 km S of San Cristóbal, Rancho Belén.

Etymology. Like poa formed from “Mt. Poas”, the name chia is formed from Chiapas, for the type locality of this species. The name is a noun in apposition.

Distribution. Confirmed from Mexico: Chiapas, Guatemala, and El Salvador.