Grishin, Zhang & Cong & Shen & Song & Grishin, 2023

Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina & Grishin, Nick V., 2023, Genomic analysis reveals new species and subspecies of butterflies, The Taxonomic Report of the International Lepidoptera Survey 11 (6), pp. 1-63 : 51-52

Lon ma Grishin , new species

http://zoobank.org/ 74F97D16-BF2C-414A-B090-BEDAEED53343 ( Figs. 50c, 51 part)

Definition and diagnosis. Genomic trees of specimens identified as Lon zabulon (Boisduval & Le Conte, [1837]) ( type locality in North America, possibly USA: Georgia) reveal their partitioning into three clades: from the USA, which is L. zabulon in accord with its phenotype and the type locality, and two others that do not have names ( Fig. 51). One of these clades ( Fig. 51 blue) is described as a new species above. The second clade consists of specimens from Panama ( Fig. 51 red) and differs from L. zabulon by Fst / Gmin /COI barcode of 0.50/0.009/2.3% (15 bp) and from L. co sp. n. by 0.47/0.008/3.2% (21 bp), thus representing a new species. This species differs from L. zabulon in being brighter colored and more orange; the orange-yellow patch on dorsal hindwing smaller, more like a patch than the entire hindwing being orange with brown borders, brown border wider; beneath brown spots larger; and from L. co sp. n. in more extensive orange-yellow areas on the forewing, e.g., submarginal and subapical forewing spots larger, on ventral side subapical triplet of spots more orange, like submarginal doublet, not yellower than it; and the absence of pale ray along dorsal hindwing 1b vein that is usually expressed in L. co sp. n. and L. zabulon . Definitive identification is provided by DNA, and a combination of the following characters is diagnostic in the nuclear genome: aly525.115.3:G328A, aly 2336.10.2:C108T, aly 2336.10.2:G116A, aly923. 19.4:T246G, aly923.19.4:C393T and in COI barcode: T79C, T169C, T206C, A349G, A577G.

Barcode sequence of the holotype. Sample NVG-18115B09, GenBank OR837742, 658 base pairs: AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATATTAGGAACTTCTTTAAGATTATTAATTCGTACAGAATTAGGCAATCCTGGATCTTTAATCGGAGATGATCAAATTTATAACACT ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCCATTATAATTGGAGGATTTGGAAATTGATTAGTACCACTAATATTAGGAGCTCCTGATATAGCTTTCCCTCGAA TAAATAATATAAGTTTTTGAATATTACCCCCTTCACTAACATTATTAATTTCAAGAAGAATTGTAGAAAATGGTGCAGGAACAGGTTGAACTGTTTACCCCCCCTTGTCATCTAATATTGC TCATCAAGGATCCTCAGTTGATTTAGCAATTTTTTCTCTTCATTTAGCTGGAATTTCATCTATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAAAAATTTAATG TTTGACCAAATACCTTTATTTGTATGATCTGTAGGTATTACAGCTTTATTATTACTTTTATCTTTACCTGTTTTAGCTGGAGCTATTACTATGTTACTTACTGATCGAAATTTAAATACTT CATTTTTTGATCCAGCAGGAGGAGGAGATCCAATTTTATATCAACACTTATTC

Type material. Holotype: ♂ deposited in the National Museum of Natural History, Washington, DC, USA [ USNM], illustrated in Fig. 50c, bears four printed (date handwritten) labels: three white [ PANAMA: Chiriqui | Volcan Baru 1800 m | 5 Dec.'76 | leg. S. S. Nicolay], [DNA sample ID: | NVG-18115B09 | c/o Nick V. Grishin ], [USNMENT | {QR Code} | 01531557], and one red [ HOLOTYPE ♂ | Lon ma | Grishin ]. Paratype: 1♂ Panama, Chiriqui, Volcan Baru, el. 1759 m, GPS 8.683, −82.500, 14- Feb-1981, G. B. Small leg. (NVG-18115B08, USNMENT 01531556) [ USNM].

Type locality. Panama: Chiriquí, Volcán Barú , elevation ca. 1800 m .

a noun in apposition.

Distribution. Currently known only from Chiriquí, Panama.