Heliopetes ( Heliopetes ) acuta, Zhang & Cong & Shen & Song & Grishin, 2024
|
publication ID |
2B44E674-0784-4977-ADE5-A8AD69E30582 |
|
publication LSID |
lsid:zoobank.org:pub:2B44E674-0784-4977-ADE5-A8AD69E30582 |
|
persistent identifier |
https://treatment.plazi.org/id/C45B002E-FFF1-FFAD-E1BE-A8AE737C3009 |
|
treatment provided by |
Felipe |
|
scientific name |
Heliopetes ( Heliopetes ) acuta |
| status |
new species |
Heliopetes ( Heliopetes) acuta Grishin, new species
http://zoobank.org/ E7DBBCD3-4C99-4421-B3AB-D755D72CD7F3
( Figs. 24 part, 25)
Definition and diagnosis. Genome-based phylogeny places one specimen from Oaxaca, Mexico, tentatively identified by us as Heliopetes ( Heliopetes) lana Grishin, 2023 ( type locality in Guatemala) as sister to the clade of three species: H. lana , Heliopetes alana (Reakirt, 1868) ( type locality in Colombia), and Heliopetes chimbo Evans, 1953 ( type locality in Ecuador) ( Fig. 24) and, therefore, represents a species distinct from them. The COI barcode of the new species differs by 2.1% (14 bp) from H. lana , 1.7% (11 bp) from H. alana , and 1.8% (12 bp) from H. chimbo . Curiously, the geographically closest and possibly sympatric H. lana has the COI barcode most different from the new species. This new species keys to H. alana (G.2.12) in Evans (1953) and differs from its relatives by better defined and larger pale triangles with sharper points at the outer margin of the ventral forewing, particularly at the apex, and brownish gray anal fold on the dorsal hindwing (typically white in H. lana and H. alana ) ( Fig. 25). Because the phenotypic variation of this species has not been explored, definitive identification is provided by DNA, and a combination of the following characters is diagnostic in the nuclear genome: aly 2532.4.3:A174G, aly 2532.4.3:T345A, aly 2532.4.3:C360T, aly 2532.4.3:A363G, aly 2633.1.13:T141C, aly259.26.1:C599C (not G), aly259.26.1:T619T (not C), aly235.14.1:C2784C (not T), aly235.14.1:A2829A (not G), aly1603.14.1:A294A (not G) and in COI barcode: C3T, C133T, T178T, T235T, T376A, C610T, T613T.
Barcode sequence of the holotype: Sample NVG-22105D09, GenBank PP254258, 658 base pairs: AATTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGTACTTCTTTAAGTTTATTAATTCGAACTGAATTAGGAAATCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTCATAGTAATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTACCTTTAATATTAGGAGCCCCAGATATAGCATTTCCTCGTA TAAATAATATAAGATTTTGACTTTTACCCCCATCCCTAACATTATTAATTTCAAGAAGTGTAGTAGAAAATGGAGCAGGAACTGGTTGAACAGTTTACCCCCCTCTCTCGGCTAATATCGC CCATCAAGGATCATCTGTTGATTTAGCTATTTTTTCTTTACATTTAGCTGGAATTTCATCTATCTTAGGAGCTATTAATTTTATTACAACTATTATTAATATACGTATTAGAAATATATCA TTTGACCAAATACCTTTATTTGTATGAGCAGTAGGAATTACTGCTTTATTACTACTATTATCATTACCTGTTTTAGCAGGTGCTATTACAATATTATTAACAGATCGAAATTTAAATACAT CATTTTTTGATCCTGCTGGAGGAGGAGATCCTATTTTATATCAACATTTATTC
Type material. Holotype: ♂ deposited in the California Academy of Sciences, San Francisco, CA, USA [ CAS], illustrated in Fig. 25, bears seven printed (dates and the species name on the 4 th label handwritten): six white [ MEX.: Oaxaca, | Candelaria Loxicha | 500 m; IX-15-73], [rec’d from | P. Hubbell], [Collection of | C. D. MacNeill], [ Heliopetes | alana (Reak.) | Det. C.D. MacNeill '75], [DNA sample ID: | NVG-22105D09 | c/o Nick V. Grishin ], [{QR Code} CASENT | 8568387], and one red [ HOLOTYPE ♂ | Heliopetes (Heliopetes) | acuta Grishin].
Type locality. Mexico: Oaxaca, Candelaria Loxicha .
Etymology. In Latin, acutus means sharp, pointed, or keen, from which we form the noun acuta and use it in apposition. The name refers to sharp and pointed marginal white triangles on the ventral forewing of this species.
Distribution. Known only from Oaxaca in Mexico.
| CA |
Chicago Academy of Sciences |
| CAS |
California Academy of Sciences |
| V |
Royal British Columbia Museum - Herbarium |
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
