Ithomiola ( Ithomiola ) tesseroides, Zhang & Cong & Shen & Song & Grishin, 2024
|
publication ID |
2B44E674-0784-4977-ADE5-A8AD69E30582 |
|
publication LSID |
lsid:zoobank.org:pub:2B44E674-0784-4977-ADE5-A8AD69E30582 |
|
persistent identifier |
https://treatment.plazi.org/id/C45B002E-FFE5-FF86-E190-ABF27243339D |
|
treatment provided by |
Felipe |
|
scientific name |
Ithomiola ( Ithomiola ) tesseroides |
| status |
new species |
Ithomiola ( Ithomiola) tesseroides Grishin, new species
http://zoobank.org/ 3400B799-BD7D-4126-95CE-0CF0766956D6
( Figs. 9 part, 10a)
Definition and diagnosis. Genome-based phylogeny of Ithomiola ( Ithomiola) C. Felder & R. Felder, 1865 ( type species Ithomiola floralis C. Felder & R. Felder, 1865 ) reveals that specimens from Panama ( Fig. 9 red) identified as Ithomiola tessera J. Hall, 2005 , stat. nov. ( type locality in Mexico: Veracruz) ( Fig. 9 blue) due to their large and blotchy white discal spots on the forewing are genetically differentiated from it at the species level ( Fig. 9), e.g., their COI barcodes differ by 3.0% (20 bp), and therefore represent a new species. This species differs from its relatives by large and aligned discal white macules on the forewing that touch each other, as in I. tessera , from which its females can be differentiated by typically larger discal macules on both wings (but usually smaller postdiscal spots) and hindwing discal macule stronger separated from costa by brown: small white spot in cell Sc+R 1 -Rs instead of a larger spot in typical I. tessera ; and putative males (none sequenced) differ by more extensive blue scaling in the tornal area of dorsal hindwing. Because phenotypic variation of this species has not been explored and due to the absence of confirmed males, definitive identification is provided by DNA, and a combination of the following characters is diagnostic in the nuclear genome: cne2399.14.5:A156G, cne6395.2.1:T631C, cne 1958.7.3:T204C, cne 1958.7.3:C477T, cne 1661.11.5:T813C and in COI barcode: A277C, C343T, T382A, T595C, T634C.
Barcode sequence of the holotype: Sample NVG-23013H06, GenBank PP254245, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTTGGTACATCTTTAAGTTTATTAATTCGTATAGAATTAGGTATACCTGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGTTTTGGAAATTGACTTGTTCCTTTAATATTAGGAGCTCCAGATATAGCTTTTCCTCGTA TAAATAATATAAGATTTTGACTTCTTCCTCCTTCCTTATTTCTTCTTATTTCAAGAAGAATTGTTGAAAATGGTGCAGGTACTGGATGAACTGTTTACCCTCCTTTATCTTCTAACATTGC TCATGGAGGATCTTCTGTAGATTTAGCAATTTTCTCATTACATTTAGCAGGTATTTCATCAATTTTAGGAGCTATTAATTTTATTACAACTATTATTAATATACGTATTAATAATTTATCA TTTGATCAAATACCTTTATTTGTATGATCTGTAGGAATTACAGCATTATTATTACTTTTATCTTTACCTGTATTAGCAGGTGCAATTACTATATTATTAACAGACCGAAACTTAAATACTT CATTTTTTGACCCTGCTGGAGGAGGTGACCCTATTCTTTATCAACATTTATTT
Type material. Holotype: ♀ deposited in the Zoologische Staatssammlung München , Germany [ ZSMC], illustrated in Fig. 10a, bears three printed labels: two white [ Chiriqui], [DNA sample ID: | NVG-23013H06 | c/o Nick V. Grishin ] and one red [ HOLOTYPE ♀ | Ithomiola (Ithomiola) | tesseroides Grishin] . Paratype: 1♀ with two original labels [920], [ Theages | Godm. & Salv. | Amaz.], likely mislabeled from Panama and might also be from Chiriqui (NVG-23013H12, GenBank barcode PP254246 ) [ ZSMC] .
Type locality. Panama: Chiriqui .
Etymology. Formed from the name of I. tessera , which is a more northern species with similarly large and squarish adjoining discal forewing spots. In Latin, tessera means a square piece of stone, and it was given to that species for the forewing spots. The name is an adjective.
Distribution. Panama (at least).
| ZSMC |
Zoologische Staatssammlung |
| V |
Royal British Columbia Museum - Herbarium |
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
