Latouchia wenchuan Hao, Yu & Zhang, 2025
|
publication ID |
https://doi.org/10.3897/BDJ.12.e137852 |
|
publication LSID |
lsid:zoobank.org:pub:2626A1F9-100B-4C92-9740-6C3DBED9A947 |
|
DOI |
https://doi.org/10.5281/zenodo.14587184 |
|
persistent identifier |
https://treatment.plazi.org/id/BAC96581-920F-520D-B609-299209E6AF66 |
|
treatment provided by |
|
|
scientific name |
Latouchia wenchuan Hao, Yu & Zhang |
| status |
sp. nov. |
Latouchia wenchuan Hao, Yu & Zhang sp. nov.
Materials
Type status: Holotype. Occurrence: recordedBy: S. Zheng; sex: male; occurrenceID: F52E6726-346A-534A-9BCF-60F1281E11AC; Taxon: scientificName: Latouchia wenchuan sp. nov.; Location: country: China; stateProvince: Sichuan; county: Wenchuan; locality: near Wenchuan Museum ; verbatimElevation: 1377 m; verbatimCoordinates: 31.4706 ° N, 103.5829 ° E; Identification: identifiedBy: L. Hao; Event: eventDate: 27 May 2023; Record Level: institutionCode: MHBU-ARA- 10000055; KYUARA # 1983 GoogleMaps
Description
Male ( Holotype, MHBU-ARA- 10000055). Colouration in ethanol (Fig. 9 View Figure 9 A). Carapace yellowish-brown, with eye mound (Fig. 9 View Figure 9 C), fovea, chelicerae and outer edge of carapace darker; area between eye mound and fovea with slightly darker colour subtriangular band. Legs colour as carapace. Opisthosoma: Dorsal side grey; ventral side slightly more yellow than dorsal side (Fig. 9 View Figure 9 B). Ventral side of whole body generally brighter than dorsal side; sigilla lighter than rest of sternum (Fig. 9 View Figure 9 D).
Total length 9.22. Carapace 5.03 long, 4.31 wide; opisthosoma 4.17 long, 2.85 wide. Eye group 0.50 long, 0.45 wide anteriorly, 0.68 wide posteriorly; MOA 0.33 long, front width 0.22, back width 0.38. Eye diameters and interdistance: AME 0.11, ALE 0.25, PME 0.15, PLE 0.19, AME – AME 0.14, AME – ALE 0.12, ALE – PLE 0.13, PME – PME 0.30, PME – PLE 0.07. Palpal coxa 1.51 long, 0.81 wide, bearing 18 / 16 spinules on prolateral-proximal corner. Sternum 3.23 long, 2.46 wide. Labium 0.52 long, 0.87 wide, without cuspule or spinule. Chelicerae without stridulatory ridges; rastellum of left and right chelicerae carrying five and four stout spines, respectively; chelicerae groove with 4 / 4 and 3 / 3 teeth of different sizes on promargin and retromargin, respectively.
Leg formula 4123; measurements: I 15.75 (4.84, 2.29, 3.77, 3.21, 1.64), II 12.29 (3.42, 1.94, 2.94, 2.68, 1.31), III 11.60 (3.33, 1.26, 2.05, 2.93, 2.03), IV 16.19 (4.61, 1.49, 3.57, 4.34, 2.18). Spines on femora to metatarsi of legs I – II straight, sword-like (typical); spines on the prolateral patellae of leg I-II typical, ventrally strong on leg I (especially distally), tip hooked, but absent on leg II; spines on prolateral tibiae several typical, less numerous on leg II, ventrally more elongate, two especially elongate adjacent spines proximally on leg II (Fig. 11 View Figure 11 F and Fig. 16 a View Figure 16 a , b View Figure 16 b ). Short spines on tarsi I – II, spineless III-IV. Spination of right leg I, patellae, Dpv (1), Mrd (1-1 - 1), rv (1-1 - 2); tibiae, Drv (2), pv (1-1 - 2 - 1 - 2 - 2 - 2 - 1 - 2), rl (1-1 - 2 - 2 - 3 - 1 - 2); metatarsi, pl (2-2 - 1 - 1 - 1 - 1 - 1), rl (2-2 - 1 - 1 - 2 - 1 - 2); tarsi, Mp (1-1 - 1), Mr (1-1 - 1 - 1 - 1). Spination of leg II, patellae, Mpd (1-1 - 2) / (1-1 - 2), Drv (1) / (0); tibiae, Mp (1-1 - 1) / (1-1 - 1 - 1), Dpv (2) / (2), rv (2-1 - 1 - 1) / (2-1 - 1 - 2), Drv (1) / (2); metatarsi, pl (1-1 - 1 - 1 - 1 - 1 - 1 - 1 - 2) / (1-1 - 2 - 1 - 1 - 1 - 3); tarsi, Mp (1-1 - 1 - 1 - 1 - 1) / (1-1 - 1 - 1 - 1), Mr (1) / (1-1 - 1). Tibia III unmodified, without demi-saddle shape. Trichobothria of legs present on proximal one-third part of tibiae I – IV, distal half of metatarsi I – III, distal two-thirds part of metatarsus IV and dorsal side of all tarsi; trichobothria on tibiae I – IV and metatarsi I – IV unmodified; trichobothria on tarsi divided into unmodified and clavate forms, with former irregularly distributed across almost entire dorsal surface and latter only present in proximal half. Count of trichobothria on legs: I, tibia 3 pd and 2 rd, metatarsus 7, tarsus 14 unmodified and 4 clavate; II, tibia 4 / 5 pd and 3 / 4 rd, metatarsus 7 / 7, tarsus 11 / 15 unmodified and 3 / 7 clavate; III, tibia 4 / 5 pd and 4 / 5 rd, metatarsus 7 / 8, tarsus 13 / 13 unmodified and 1 / 3 clavate; IV, tibia 5 / 5 pd and 6 / 6 rd, metatarsus 7 / 8, tarsus 11 / 10 unmodified and 1 / 1 clavate. Tarsal claws: paired claws with six teeth on tarsus I (Fig. 11 View Figure 11 E), four teeth on tarsi II – III, two teeth on tarsus IV, unpaired claw bare, without denticle.
Palp 6.62 long (2.81, 0.99, 2.05, 0.77). Trichobothria on palpal tibia unmodified, present on proximal half part, on cymbium divided into unmodified and clavate forms, with latter occupying majority of trichobothrial area, while former sparsely distributed at distal end of trichobothrial area; count of trichobothria: tibia 1 / 3 pd, 2 / 3 rd, cymbium 2 / 4 unmodified and 1 / 3 clavate. Tibia cylindrical, slightly outwards in the middle ventral, with one lyriform organ on ventro-prolateral side of sub-distal part (Fig. 9 View Figure 9 E – F). Spination of tibia, Dmp (1-1 - 1 - 1) / (1-1 - 1 - 1), Mr (7) / (7). Palpal organ: tegulum oval; embolus approximately 1.3 times the tegulum width, with one elevated embolic keel extending from retrolateral side of proximal one-third part of embolus to distal one-third part of ventral side (Fig. 10 View Figure 10 D – F); embolus slight bent to retrolateral at distal one-third part of embolus; apex of embolus with an apophysis (Fig. 10 View Figure 10 C).
Diagnosis
The male of new species morphologically resembles those of geographically close L. yaoi sp. nov. on the general morphology of palpal bulb and the pattern of spines on the palpal tibia, but it can be distinguished from L. yaoi by the relatively low keel of embolus and the reduction of number of spines on male palpal tibia (Fig. 9 View Figure 9 E – F and Fig. 13 View Figure 13 F – G). Another species known only from a historical female specimen from the same wider zone is L. davidi (i. e. from Moupingzhen, Sichuan). Whilst direct comparisons are problematic due to sexual dimorphism, the male L. wenchuan sp. nov. lacks stridulatory ridges on the retrolateral checlicerae as found in the female of L. davidi ( Decae and Caranhac 2020) , but which may be expected in the undescribed male as similar structures are found in both sexes on L. stridulans ( Decae et al. 2019) .
Etymology
The specific epithet is derived from the type locality; noun in apposition.
Distribution
Known only from the type locality of Sichuan, China (Fig. 17 View Figure 17 ).
DNA barcode
AAAGATATTGGAACTTTATATATGATTTTTGGTGTATGATCGGCTATGCTAGGGACTGCTATAAGAGTAATTATTCGAGTTGAGCTTGGTCAGGTTGGTAGATTGTTTGGGGATGATCATTTGTATAATGTTATTGTTACTGCTCATGCTTTAGTTATGATTTTTTTTATAGTTATGCCTATTATAATTGGTGGTTTTGGGAATTGATTGCTTCCATTAATGATTGGTTCACCAGATATGGCTTTTCCTCGTATAAATAATTTAAGATTTTGATTGCTTTTCCCTTCTTTATTTTTATTGTTGTTATCTTCTATAACGGATATTGGGGTGGGTGCTGGATGGACTATTTATCCTCCATTATCTTCTGATTTAGGACATAGAGGAGGAGGGGTAGATTTTGCTATTTTTTCTCTTCATTTGGCTGGAGGGTCTTCAGTAATAGGTTCTATTAATTTTATTTCTACTATTTTTAATATACGTCCTTTTGGGATAACAATAGAACGAGTTCCTTTATTTGTGTGATCTGTGTTAATTACAACTATTTTGCTTTTATTGTCTTTGCCAGTTTTAGCTGGAGCTATTACTATACTATTAACTGATCGAAATTTTAATACTTCATTTTTTGATCCTGCTGGTGGTGGGGATCCGGTATTATTTCAGCATTTGTTTTGATTTTTTGGTCAC (GenBank accession number: PQ 585637).
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
