Amenis ponina rogeri Orellana, [2010]
|
publication ID |
https://doi.org/10.11646/zootaxa.5319.4.7 |
|
publication LSID |
lsid:zoobank.org:pub:AE993A70-D5C2-46E3-A570-40EF0DB7ECC2 |
|
DOI |
https://doi.org/10.5281/zenodo.8211460 |
|
persistent identifier |
https://treatment.plazi.org/id/AF07C417-FFAA-2D5A-15F7-F9179023FD74 |
|
treatment provided by |
Plazi |
|
scientific name |
Amenis ponina rogeri Orellana, [2010] |
| status |
stat. nov. |
Amenis ponina rogeri Orellana, [2010] , stat. nov.
The original description of Amenis rogeri Orellana, [2010] discussed and illustrated the similarity of its genitalia with Amenis ponina (Herrich-Schäffer, 1869) , suggesting that there are no diagnostic differences in their genitalia: “y dado la variabilidad individual observada en ambas especies, podemos afirmar que tales estructuras son iguales.” ( Orellana [2010]). Equally, we found strong genetic similarities between A. rogeri and A. ponina : the holotype of A. rogeri (in MIZA) is sister to the two specimens of A. ponina and is closer to them that any other pair of species in the trees ( Fig. 1 View FIGURE 1 ). Their COI barcodes differ by only 0.5% (3 bp). The major difference between A. rogeri and A. ponina is in their wing patterns: A. rogeri is unexpectedly more similar to A. pionia (e.g., both have whitish fringes) than to A. ponina (distinctly orange fringes), as detailed in the original description ( Orellana [2010]). Therefore, due to the lack of genitalic and genetic differences at the level characteristic for species-level, we propose to treat A. rogeri as a subspecies: Amenis ponina rogeri Orellana, [2010] , stat. nov. However, we sequenced only one A. p. rogeri specimen (the holotype), and we have not yet studied Amenis pionia sandra Orellana, [2010] . Hence, additional work on these taxa may bring further insights. The COI barcode sequence of the holotype of A. p. rogeri , sample NVG-22029C08, GenBank accession OR178491, 658 base pairs is:
AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAATTGGAACATCTTTAAGACTATTAATCCGAACTGAATTAGGAACTCCAGGATCTTTAATTGGA GACGATCAAATTTATAATACTATTGTAACAGCTCATGCATTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGAAATTGATTAG TCCCTCTTATATTAGGAGCCCCTGATATAGCTTTCCCCCGAATAAATAATATAAGATTTTGATTATTACCCCCTTCATTAATTCTACTTATTTCTAGCAG TATTGTAGAAAATGGTGCTGGAACTGGATGAACTGTTTACCCTCCTCTTTCTTCTAATATTGCTCATCAAGGAGCTTCTGTAGATTTAGCTATTTTTTCC CTACATTTAGCTGGAATTTCATCAATTTTAGGAGCTATTAATTTTATTACAACAATCATTAATATACGAATTAAAAATTTATCTTTTGACCAAATACCTT TATTTGTATGAGCTGTTGGTATTACAGCATTATTATTACTTTTATCTTTACCTGTTTTAGCAGGAGCTATTACAATATTATTAACAGACCGAAATATTAA TACTTCTTTTTTTGATCCTGCAGGAGGAGGAGATCCTATTTTATACCAACATCTATTT
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
|
Kingdom |
|
|
Phylum |
|
|
Class |
|
|
Order |
|
|
Family |
|
|
Genus |
