Venanus johnnyrosalesi Fernandez-Triana & Whitfield

Fernandez-Triana, Jose L, Whitfield, James B, Smith, M. Alex, Hallwachs, Winnie & Janzen, Daniel H., 2014, First record of the genus Venanus (Hymenoptera: Braconidae: Microgastrinae) in Mesoamerica, with the description of two new species from Costa Rica, Biodiversity Data Journal 2, pp. 4167-4167 : 4167

publication ID

https://dx.doi.org/10.3897/BDJ.2.e4167

persistent identifier

https://treatment.plazi.org/id/A4DF26CF-A6CC-7DFB-4BB5-76F4566C949B

treatment provided by

Biodiversity Data Journal by Pensoft (2019-03-21 00:03:52, last updated 2022-11-10 23:26:29)

scientific name

Venanus johnnyrosalesi Fernandez-Triana & Whitfield
status

sp. n.

Venanus johnnyrosalesi Fernandez-Triana & Whitfield   ZBK sp. n.

Materials

Type status: Holotype. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu/caterpillars/database.lasso; catalogNumber: DHJPAR0031445 ; recordedBy: D.H.Janzen&W.Hallwachs; individualID: DHJPAR0031445; individualCount: 1; sex: Female; lifeStage: adult; otherCatalogNumbers: 08-SRNP-38355; Taxon: scientificName: Venanusjohnnyrosalesi; phylum: Arthropoda; class: Insecta; order: Hymenoptera; family: Braconidae; genus: Venanus; specificEpithet: johnnyrosalesi; scientificNameAuthorship: Fernández-Triana; Location: continent: Central America; country: Costa Rica; stateProvince: Guanacaste; locality: Area de Conservacion Guanacaste ; verbatimLocality: Sendero Cima; verbatimElevation: 1460 m; verbatimLatitude: 10.9333; verbatimLongitude: -85.4573; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.9333; decimalLongitude: -85.4573; Identification: dateIdentified: 2014; Event: samplingProtocol: Malaise Trap; verbatimEventDate: 11/17/2008; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: PreservedSpecimen GoogleMaps Type status: Paratype. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu/caterpillars/database.lasso; catalogNumber: DHJPAR0031434 ; recordedBy: D.H.Janzen&W.Hallwachs; individualID: DHJPAR0031434; individualCount: 1; sex: Female; lifeStage: adult; otherCatalogNumbers: 08-SRNP-38344; Taxon: scientificName: Venanusjohnnyrosalesi; phylum: Arthropoda; class: Insecta; order: Hymenoptera; family: Braconidae; genus: Venanus; specificEpithet: johnnyrosalesi; scientificNameAuthorship: Fernández-Triana; Location: continent: Central America; country: Costa Rica; stateProvince: Guanacaste; locality: Area de Conservacion Guanacaste ; verbatimLocality: Sendero Cima; verbatimElevation: 1460 m; verbatimLatitude: 10.9333; verbatimLongitude: -85.4573; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.9333; decimalLongitude: -85.4573; Identification: dateIdentified: 2014; Event: samplingProtocol: Malaise Trap; verbatimEventDate: 10/27/2008; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: PreservedSpecimen GoogleMaps Type status: Paratype. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu/caterpillars/database.lasso; catalogNumber: DHJPAR0031452 ; recordedBy: D.H.Janzen&W.Hallwachs; individualID: DHJPAR0031452; individualCount: 1; sex: Female; lifeStage: adult; otherCatalogNumbers: 08-SRNP-38362; Taxon: scientificName: Venanusjohnnyrosalesi; phylum: Arthropoda; class: Insecta; order: Hymenoptera; family: Braconidae; genus: Venanus; specificEpithet: johnnyrosalesi; scientificNameAuthorship: Fernández-Triana; Location: continent: Central America; country: Costa Rica; stateProvince: Guanacaste; locality: Area de Conservacion Guanacaste ; verbatimLocality: Sendero Cima; verbatimElevation: 1460 m; verbatimLatitude: 10.9333; verbatimLongitude: -85.4573; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.9333; decimalLongitude: -85.4573; Identification: dateIdentified: 2014; Event: samplingProtocol: Malaise Trap; verbatimEventDate: 12/01/2008; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: PreservedSpecimen GoogleMaps Type status: Paratype. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu/caterpillars/database.lasso; catalogNumber: DHJPAR0031455 ; recordedBy: D.H.Janzen&W.Hallwachs; individualID: DHJPAR0031455; individualCount: 1; sex: Male; lifeStage: adult; otherCatalogNumbers: 08-SRNP-38365; Taxon: scientificName: Venanusjohnnyrosalesi; phylum: Arthropoda; class: Insecta; order: Hymenoptera; family: Braconidae; genus: Venanus; specificEpithet: johnnyrosalesi; scientificNameAuthorship: Fernández-Triana; Location: continent: Central America; country: Costa Rica; stateProvince: Guanacaste; locality: Area de Conservacion Guanacaste ; verbatimLocality: Sendero Cima; verbatimElevation: 1460 m; verbatimLatitude: 10.9333; verbatimLongitude: -85.4573; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.9333; decimalLongitude: -85.4573; Identification: dateIdentified: 2014; Event: samplingProtocol: Malaise Trap; verbatimEventDate: 12/15/2008; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: PreservedSpecimen GoogleMaps Type status: Paratype. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu/caterpillars/database.lasso; catalogNumber: DHJPAR0031456 ; recordedBy: D.H.Janzen&W.Hallwachs; individualID: DHJPAR0031456; individualCount: 1; sex: Male; lifeStage: adult; otherCatalogNumbers: 08-SRNP-38366; Taxon: scientificName: Venanusjohnnyrosalesi; phylum: Arthropoda; class: Insecta; order: Hymenoptera; family: Braconidae; genus: Venanus; specificEpithet: johnnyrosalesi; scientificNameAuthorship: Fernández-Triana; Location: continent: Central America; country: Costa Rica; stateProvince: Guanacaste; locality: Area de Conservacion Guanacaste ; verbatimLocality: Sendero Cima; verbatimElevation: 1460 m; verbatimLatitude: 10.9333; verbatimLongitude: -85.4573; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.9333; decimalLongitude: -85.4573; Identification: dateIdentified: 2014; Event: samplingProtocol: Malaise Trap; verbatimEventDate: 12/15/2008; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: PreservedSpecimen GoogleMaps Type status: Paratype. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu/caterpillars/database.lasso; catalogNumber: DHJPAR0031461 ; recordedBy: D.H.Janzen&W.Hallwachs; individualID: DHJPAR0031461; individualCount: 1; sex: Male; lifeStage: adult; otherCatalogNumbers: 08-SRNP-38371; Taxon: scientificName: Venanusjohnnyrosalesi; phylum: Arthropoda; class: Insecta; order: Hymenoptera; family: Braconidae; genus: Venanus; specificEpithet: johnnyrosalesi; scientificNameAuthorship: Fernández-Triana; Location: continent: Central America; country: Costa Rica; stateProvince: Guanacaste; locality: Area de Conservacion Guanacaste ; verbatimLocality: Sendero Cima; verbatimElevation: 1460 m; verbatimLatitude: 10.9333; verbatimLongitude: -85.4573; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.9333; decimalLongitude: -85.4573; Identification: dateIdentified: 2014; Event: samplingProtocol: Malaise Trap; verbatimEventDate: 12/22/2008; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: PreservedSpecimen GoogleMaps Type status: Paratype. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu/caterpillars/database.lasso; catalogNumber: DHJPAR0031462 ; recordedBy: D.H.Janzen&W.Hallwachs; individualID: DHJPAR0031462; individualCount: 1; sex: Male; lifeStage: adult; otherCatalogNumbers: 08-SRNP-38372; Taxon: scientificName: Venanusjohnnyrosalesi; phylum: Arthropoda; class: Insecta; order: Hymenoptera; family: Braconidae; genus: Venanus; specificEpithet: johnnyrosalesi; scientificNameAuthorship: Fernández-Triana; Location: continent: Central America; country: Costa Rica; stateProvince: Guanacaste; locality: Area de Conservacion Guanacaste ; verbatimLocality: Sendero Cima; verbatimElevation: 1460 m; verbatimLatitude: 10.9333; verbatimLongitude: -85.4573; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.9333; decimalLongitude: -85.4573; Identification: dateIdentified: 2014; Event: samplingProtocol: Malaise Trap; verbatimEventDate: 12/22/2008; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: PreservedSpecimen GoogleMaps Type status: Paratype. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu/caterpillars/database.lasso; catalogNumber: DHJPAR0031466 ; recordedBy: D.H.Janzen&W.Hallwachs; individualID: DHJPAR0031466; individualCount: 1; sex: Female; lifeStage: adult; otherCatalogNumbers: 08-SRNP-38376; Taxon: scientificName: Venanusjohnnyrosalesi; phylum: Arthropoda; class: Insecta; order: Hymenoptera; family: Braconidae; genus: Venanus; specificEpithet: johnnyrosalesi; scientificNameAuthorship: Fernández-Triana; Location: continent: Central America; country: Costa Rica; stateProvince: Guanacaste; locality: Area de Conservacion Guanacaste ; verbatimLocality: Sendero Cima; verbatimElevation: 1460 m; verbatimLatitude: 10.9333; verbatimLongitude: -85.4573; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.9333; decimalLongitude: -85.4573; Identification: dateIdentified: 2014; Event: samplingProtocol: Malaise Trap; verbatimEventDate: 12/29/2008; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: PreservedSpecimen GoogleMaps Type status: Paratype. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu/caterpillars/database.lasso; catalogNumber: DHJPAR0031470 ; recordedBy: D.H.Janzen&W.Hallwachs; individualID: DHJPAR0031470; individualCount: 1; sex: Male; lifeStage: adult; otherCatalogNumbers: 08-SRNP-38380; Taxon: scientificName: Venanusjohnnyrosalesi; phylum: Arthropoda; class: Insecta; order: Hymenoptera; family: Braconidae; genus: Venanus; specificEpithet: johnnyrosalesi; scientificNameAuthorship: Fernández-Triana; Location: continent: Central America; country: Costa Rica; stateProvince: Guanacaste; locality: Area de Conservacion Guanacaste ; verbatimLocality: Sendero Cima; verbatimElevation: 1460 m; verbatimLatitude: 10.9333; verbatimLongitude: -85.4573; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.9333; decimalLongitude: -85.4573; Identification: dateIdentified: 2014; Event: samplingProtocol: Malaise Trap; verbatimEventDate: 01/05/2009; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: PreservedSpecimen GoogleMaps Type status: Paratype. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu/caterpillars/database.lasso; catalogNumber: DHJPAR0031472 ; recordedBy: D.H.Janzen&W.Hallwachs; individualID: DHJPAR0031472; individualCount: 1; sex: Male; lifeStage: adult; otherCatalogNumbers: 08-SRNP-38382; Taxon: scientificName: Venanusjohnnyrosalesi; phylum: Arthropoda; class: Insecta; order: Hymenoptera; family: Braconidae; genus: Venanus; specificEpithet: johnnyrosalesi; scientificNameAuthorship: Fernández-Triana; Location: continent: Central America; country: Costa Rica; stateProvince: Guanacaste; locality: Area de Conservacion Guanacaste ; verbatimLocality: Sendero Cima; verbatimElevation: 1460 m; verbatimLatitude: 10.9333; verbatimLongitude: -85.4573; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.9333; decimalLongitude: -85.4573; Identification: dateIdentified: 2014; Event: samplingProtocol: Malaise Trap; verbatimEventDate: 01/12/2009; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: PreservedSpecimen GoogleMaps Type status: Paratype. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu/caterpillars/database.lasso; catalogNumber: DHJPAR0031473 ; recordedBy: D.H.Janzen&W.Hallwachs; individualID: DHJPAR0031473; individualCount: 1; sex: Male; lifeStage: adult; otherCatalogNumbers: 08-SRNP-38383; Taxon: scientificName: Venanusjohnnyrosalesi; phylum: Arthropoda; class: Insecta; order: Hymenoptera; family: Braconidae; genus: Venanus; specificEpithet: johnnyrosalesi; scientificNameAuthorship: Fernández-Triana; Location: continent: Central America; country: Costa Rica; stateProvince: Guanacaste; locality: Area de Conservacion Guanacaste ; verbatimLocality: Sendero Cima; verbatimElevation: 1460 m; verbatimLatitude: 10.9333; verbatimLongitude: -85.4573; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.9333; decimalLongitude: -85.4573; Identification: dateIdentified: 2014; Event: samplingProtocol: Malaise Trap; verbatimEventDate: 01/12/2009; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: PreservedSpecimen GoogleMaps Type status: Paratype. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu/caterpillars/database.lasso; catalogNumber: DHJPAR0031480 ; recordedBy: D.H.Janzen&W.Hallwachs; individualID: DHJPAR0031480; individualCount: 1; sex: Male; lifeStage: adult; otherCatalogNumbers: 08-SRNP-38390; Taxon: scientificName: Venanusjohnnyrosalesi; phylum: Arthropoda; class: Insecta; order: Hymenoptera; family: Braconidae; genus: Venanus; specificEpithet: johnnyrosalesi; scientificNameAuthorship: Fernández-Triana; Location: continent: Central America; country: Costa Rica; stateProvince: Guanacaste; locality: Area de Conservacion Guanacaste ; verbatimLocality: Sendero Cima; verbatimElevation: 1460 m; verbatimLatitude: 10.9333; verbatimLongitude: -85.4573; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.9333; decimalLongitude: -85.4573; Identification: dateIdentified: 2014; Event: samplingProtocol: Malaise Trap; verbatimEventDate: 01/26/2009; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: PreservedSpecimen GoogleMaps Type status: Paratype. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu/caterpillars/database.lasso; catalogNumber: DHJPAR0031481 ; recordedBy: D.H.Janzen&W.Hallwachs; individualID: DHJPAR0031481; individualCount: 1; sex: Male; lifeStage: adult; otherCatalogNumbers: 08-SRNP-38391; Taxon: scientificName: Venanusjohnnyrosalesi; phylum: Arthropoda; class: Insecta; order: Hymenoptera; family: Braconidae; genus: Venanus; specificEpithet: johnnyrosalesi; scientificNameAuthorship: Fernández-Triana; Location: continent: Central America; country: Costa Rica; stateProvince: Guanacaste; locality: Area de Conservacion Guanacaste ; verbatimLocality: Sendero Cima; verbatimElevation: 1460 m; verbatimLatitude: 10.9333; verbatimLongitude: -85.4573; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.9333; decimalLongitude: -85.4573; Identification: dateIdentified: 2014; Event: samplingProtocol: Malaise Trap; verbatimEventDate: 02/02/2009; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: PreservedSpecimen GoogleMaps Type status: Paratype. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu/caterpillars/database.lasso; catalogNumber: DHJPAR0031486 ; recordedBy: D.H.Janzen&W.Hallwachs; individualID: DHJPAR0031486; individualCount: 1; sex: Male; lifeStage: adult; otherCatalogNumbers: 08-SRNP-38396; Taxon: scientificName: Venanusjohnnyrosalesi; phylum: Arthropoda; class: Insecta; order: Hymenoptera; family: Braconidae; genus: Venanus; specificEpithet: johnnyrosalesi; scientificNameAuthorship: Fernández-Triana; Location: continent: Central America; country: Costa Rica; stateProvince: Guanacaste; locality: Area de Conservacion Guanacaste ; verbatimLocality: Sendero Cima; verbatimElevation: 1460 m; verbatimLatitude: 10.9333; verbatimLongitude: -85.4573; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.9333; decimalLongitude: -85.4573; Identification: dateIdentified: 2014; Event: samplingProtocol: Malaise Trap; verbatimEventDate: 03/16/2009; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: PreservedSpecimen GoogleMaps Type status: Paratype. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu/caterpillars/database.lasso; catalogNumber: DHJPAR0031487 ; recordedBy: D.H.Janzen&W.Hallwachs; individualID: DHJPAR0031487; individualCount: 1; sex: Male; lifeStage: adult; otherCatalogNumbers: 08-SRNP-38397; Taxon: scientificName: Venanusjohnnyrosalesi; phylum: Arthropoda; class: Insecta; order: Hymenoptera; family: Braconidae; genus: Venanus; specificEpithet: johnnyrosalesi; scientificNameAuthorship: Fernández-Triana; Location: continent: Central America; country: Costa Rica; stateProvince: Guanacaste; locality: Area de Conservacion Guanacaste ; verbatimLocality: Sendero Cima; verbatimElevation: 1460 m; verbatimLatitude: 10.9333; verbatimLongitude: -85.4573; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.9333; decimalLongitude: -85.4573; Identification: dateIdentified: 2014; Event: samplingProtocol: Malaise Trap; verbatimEventDate: 03/16/2009; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: PreservedSpecimen GoogleMaps Type status: Paratype. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu/caterpillars/database.lasso; catalogNumber: DHJPAR0031489 ; recordedBy: D.H.Janzen&W.Hallwachs; individualID: DHJPAR0031489; individualCount: 1; sex: Male; lifeStage: adult; otherCatalogNumbers: 08-SRNP-38399; Taxon: scientificName: Venanusjohnnyrosalesi; phylum: Arthropoda; class: Insecta; order: Hymenoptera; family: Braconidae; genus: Venanus; specificEpithet: johnnyrosalesi; scientificNameAuthorship: Fernández-Triana; Location: continent: Central America; country: Costa Rica; stateProvince: Guanacaste; locality: Area de Conservacion Guanacaste ; verbatimLocality: Sendero Cima; verbatimElevation: 1460 m; verbatimLatitude: 10.9333; verbatimLongitude: -85.4573; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.9333; decimalLongitude: -85.4573; Identification: dateIdentified: 2014; Event: samplingProtocol: Malaise Trap; verbatimEventDate: 03/23/2009; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: PreservedSpecimen GoogleMaps Type status: Paratype. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu/caterpillars/database.lasso; catalogNumber: DHJPAR0031491 ; recordedBy: D.H.Janzen&W.Hallwachs; individualID: DHJPAR0031491; individualCount: 1; sex: Male; lifeStage: adult; otherCatalogNumbers: 08-SRNP-38401; Taxon: scientificName: Venanusjohnnyrosalesi; phylum: Arthropoda; class: Insecta; order: Hymenoptera; family: Braconidae; genus: Venanus; specificEpithet: johnnyrosalesi; scientificNameAuthorship: Fernández-Triana; Location: continent: Central America; country: Costa Rica; stateProvince: Guanacaste; locality: Area de Conservacion Guanacaste ; verbatimLocality: Sendero Cima; verbatimElevation: 1460 m; verbatimLatitude: 10.9333; verbatimLongitude: -85.4573; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.9333; decimalLongitude: -85.4573; Identification: dateIdentified: 2014; Event: samplingProtocol: Malaise Trap; verbatimEventDate: 03/23/2009; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: PreservedSpecimen GoogleMaps Type status: Paratype. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu/caterpillars/database.lasso; catalogNumber: DHJPAR0031493 ; recordedBy: D.H.Janzen&W.Hallwachs; individualID: DHJPAR0031493; individualCount: 1; sex: Male; lifeStage: adult; otherCatalogNumbers: 08-SRNP-38403; Taxon: scientificName: Venanusjohnnyrosalesi; phylum: Arthropoda; class: Insecta; order: Hymenoptera; family: Braconidae; genus: Venanus; specificEpithet: johnnyrosalesi; scientificNameAuthorship: Fernández-Triana; Location: continent: Central America; country: Costa Rica; stateProvince: Guanacaste; locality: Area de Conservacion Guanacaste ; verbatimLocality: Sendero Cima; verbatimElevation: 1460 m; verbatimLatitude: 10.9333; verbatimLongitude: -85.4573; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.9333; decimalLongitude: -85.4573; Identification: dateIdentified: 2014; Event: samplingProtocol: Malaise Trap; verbatimEventDate: 03/30/2009; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: PreservedSpecimen GoogleMaps Type status: Paratype. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu/caterpillars/database.lasso; catalogNumber: DHJPAR0031494 ; recordedBy: D.H.Janzen&W.Hallwachs; individualID: DHJPAR0031494; individualCount: 1; sex: Male; lifeStage: adult; otherCatalogNumbers: 08-SRNP-38404; Taxon: scientificName: Venanusjohnnyrosalesi; phylum: Arthropoda; class: Insecta; order: Hymenoptera; family: Braconidae; genus: Venanus; specificEpithet: johnnyrosalesi; scientificNameAuthorship: Fernández-Triana; Location: continent: Central America; country: Costa Rica; stateProvince: Guanacaste; locality: Area de Conservacion Guanacaste ; verbatimLocality: Sendero Cima; verbatimElevation: 1460 m; verbatimLatitude: 10.9333; verbatimLongitude: -85.4573; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.9333; decimalLongitude: -85.4573; Identification: dateIdentified: 2014; Event: samplingProtocol: Malaise Trap; verbatimEventDate: 03/30/2009; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: PreservedSpecimen GoogleMaps Type status: Paratype. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu/caterpillars/database.lasso; catalogNumber: DHJPAR0031497 ; recordedBy: D.H.Janzen&W.Hallwachs; individualID: DHJPAR0031497; individualCount: 1; sex: Male; lifeStage: adult; otherCatalogNumbers: 08-SRNP-38407; Taxon: scientificName: Venanusjohnnyrosalesi; phylum: Arthropoda; class: Insecta; order: Hymenoptera; family: Braconidae; genus: Venanus; specificEpithet: johnnyrosalesi; scientificNameAuthorship: Fernández-Triana; Location: continent: Central America; country: Costa Rica; stateProvince: Guanacaste; locality: Area de Conservacion Guanacaste ; verbatimLocality: Sendero Cima; verbatimElevation: 1460 m; verbatimLatitude: 10.9333; verbatimLongitude: -85.4573; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.9333; decimalLongitude: -85.4573; Identification: dateIdentified: 2014; Event: samplingProtocol: Malaise Trap; verbatimEventDate: 03/02/2009; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: PreservedSpecimen GoogleMaps Type status: Paratype. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu/caterpillars/database.lasso; catalogNumber: DHJPAR0031498 ; recordedBy: D.H.Janzen&W.Hallwachs; individualID: DHJPAR0031498; individualCount: 1; sex: Male; lifeStage: adult; otherCatalogNumbers: 08-SRNP-38408; Taxon: scientificName: Venanusjohnnyrosalesi; phylum: Arthropoda; class: Insecta; order: Hymenoptera; family: Braconidae; genus: Venanus; specificEpithet: johnnyrosalesi; scientificNameAuthorship: Fernández-Triana; Location: continent: Central America; country: Costa Rica; stateProvince: Guanacaste; locality: Area de Conservacion Guanacaste ; verbatimLocality: Sendero Cima; verbatimElevation: 1460 m; verbatimLatitude: 10.9333; verbatimLongitude: -85.4573; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.9333; decimalLongitude: -85.4573; Identification: dateIdentified: 2014; Event: samplingProtocol: Malaise Trap; verbatimEventDate: 03/02/2009; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: PreservedSpecimen GoogleMaps Type status: Paratype. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu/caterpillars/database.lasso; catalogNumber: DHJPAR0031499 ; recordedBy: D.H.Janzen&W.Hallwachs; individualID: DHJPAR0031499; individualCount: 1; sex: Male; lifeStage: adult; otherCatalogNumbers: 08-SRNP-38409; Taxon: scientificName: Venanusjohnnyrosalesi; phylum: Arthropoda; class: Insecta; order: Hymenoptera; family: Braconidae; genus: Venanus; specificEpithet: johnnyrosalesi; scientificNameAuthorship: Fernández-Triana; Location: continent: Central America; country: Costa Rica; stateProvince: Guanacaste; locality: Area de Conservacion Guanacaste ; verbatimLocality: Sendero Cima; verbatimElevation: 1460 m; verbatimLatitude: 10.9333; verbatimLongitude: -85.4573; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.9333; decimalLongitude: -85.4573; Identification: dateIdentified: 2014; Event: samplingProtocol: Malaise Trap; verbatimEventDate: 04/06/2009; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: PreservedSpecimen GoogleMaps

Description

Female. Body length: 2.3 mm. Fore wing length: 2.2 mm. Flagellomere 2 length/width: 0.11 mm/0.05 mm. Flagellomere 14 length/width: 0.08 mm/0.06 mm. Oculo-ocellar distance: 0.14 mm. Distance between posterior ocelli: 0.08 mm. Diameter of posterior ocellus: 0.05 mm. Metafemur length/width: 0.52 mm/0.20 mm. Metatibia length: 0.62 mm. Mediotergite 1 length/maximum width/minimum width: 0.30/0.15/0.08 mm. Mediotergite 2 length/width at posterior margin: 0.13/0.08 mm. Figs 1, 2.

Male: As female, but metafemur thinner and antenna longer.

Diagnosis

The mediotergite 1 is relatively long and with a slight constriction near anterior end (Fig. 2). That character is also shared with other three species of Venanus . However, V. johnnyrosalesi can be separated from V. helavai by its much smaller size (2.3 mm vs 2.8-3.0 mm) and less sculptured propodeum, from V. yanayacuensis by its wider discal cell in fore wing (1.0 × vs 1.2 × as wide as high), metasoma color (brown vs black) and fore wing vein 2RS significanly longer than vein r (shorter than r in yanayacuensis ), and from V. randallgarciai by proportion of veins 2RS and r (1.4 × vs 2.0 ×), sculpture of metapleuron and mediotergite 2, and less narrow mediotergite 1 (narrowest width 0.8 × width at posterior margin vs 0.6 × in randallgarciai ).

Etymology

Venanus johnnyrosalesi is named in honor of Sr. Johnny Rosales , currently of San Jose, Costa Rica, but also a major user, appreciator and former director of ACG.

Distribution

Only know from Volcán Cacao, ACG, Costa Rica.

Notes

A total of 60 specimens (some of them not examined for this paper) were sampled for DNA, and 50 rendered full barcode sequences of 658 base pairs (see also Suppl. material 1). These sequences were characterised by very limited variation (a single synonymous, third base G/A transition). The holotype specimen (DHJPAR0031445) has the sequence accession ASHYG706-10 in BOLD (www.boldsystems.org) and the nucleotide sequence is reproduced below:

AATATTATACTTTATTTTTGGGTTATGAGCTGGTATAGTAGGATTTTCTATAAGAATAATCATTCGCTTAGAATTAGGAATACCTGGAAATTTAATTGGAAATGACCAAATTTATAATAGAATTGTTACTTCTCATGCTTTTATTATAATTTTTTTCATAGTTATACCAATCATAATTGGTGGATTTGGTAACTGATTAATTCCTTTAATATTAGGTACTCCAGATATAGCATTCCCTCGAATAAATAATATAAGATTTTGGTTACTTCTACCTTCATTATTTTTATTAATTTTAAGTAGATTTATTAATACAGGGGTAGGAACGGGATGAACAGTATACCCTCCTTTGTCATTAATTTTAGGCCATGGGGGAATATCAGTAGACCTGGGTATTTTTTCTCTTCATTTAGCAGGAATATCTTCAATTATAGGGGCTATTAATTTTATTTCCACAATTATAAATATACGAACAAATTTTTTAATAATAGACAAAATCTCTTTATTTTCATGATCTGTTTTAATTACAGCTATTTTATTACTTCTATCTTTACCAGTTTTAGCTGGAGCAATTACTATACTACTGACAGATCGAAATTTAAATACAAGATTTTTTGATCCAAGTGGAGGTGGAGATCCAATTCTTTATCAACATTTATTT

Kingdom

Animalia

Phylum

Arthropoda

Class

Insecta

Order

Hymenoptera

Family

Braconidae

Genus

Venanus