Leptopilina longipes (Hartig, 1841)

Vogel, Jonathan, Martin, Jakob, Forshage, Mattias, Salden, Tobias, Staverløkk, Arnstein, Verheyde, Fons, Nordlander, Göran, Herz, Annette & Peters, Ralph S., 2025, The Leptopilina Förster, 1869 of the Western Palearctic, and an updated list of the world species (Hymenoptera, Figitidae, Eucoilinae), Journal of Hymenoptera Research 98, pp. 915-969 : 915-969

Leptopilina longipes (Hartig, 1841)

Cothonaspis longipes Hartig, 1841: 356 .

Eucoila pusilla Giraud, 1860: 142 syn. nov. (type in MNHN studied by MF).

Rhoptromeris rutilus Belizin, 1966: 12 syn. nov. (type in ZIN studied by GN).

Diagnosis.

Leptopilina longipes is a size-variable species with relatively slender appearance, medium-long antennae, and the metasoma is notably paler than the head and mesosoma (Fig. 8 A ).

The species is unique in having the propodeal carina well separated from the mesoscutellum by a part of the metanotum (Fig. 8 E ). Other species show at most an insignificant gap.

The metapleural ridge 1 and 2 are of similar length, reaching about half the length of the metapleuron (Fig. 8 D ). In other species, the lengths of ridge 1 and 2 are dissimilar, or they reach the anterior margin of the metapleuron ( L. japonica and L. heterotoma ). Whereas other species have a more or less unicoloured body, the metasoma of L. longipes , especially of the females, is distinctly paler amber-coloured than the head and mesosoma (Fig. 8 A ). This colouration pattern is similar to that of L. fimbriata , where it is usually even more distinct. The surface anterior to the glandular pit of the mesoscutellar plate is concave and areolate (Fig. 8 C ), as it is in L. australis and L. clavipes . That area is mostly smooth in all other species. The female antenna is usually more uniformly dark, with all flagellomeres brown to dark brown (Fig. 8 B ), while all other species have at least a few proximal flagellomeres pale brown or even yellow.

Molecular characterisation.

Maximum intraspecific barcode-distance: 0.5 % (2).

Minimum interspecific barcode-distance: 14.3 % ( L. clavipes ).

Consensus barcode sequence: 658 bp.

5 ’ - TATAATATATTTTATATTTGGTATTTGATCAAGTATAGTAGGGGCAAGGCTAAGAATAATTATTCGAATAGAGTTAGGGACTGTAACTCAGTTAATTAATAATGATCAGATTTATAATTCTATTGTTACGGCTCATGCATTTGTAATAATTTTTTTTATAGTTATACCTATTATAGTGGGAGGGTTTGGTAATTATTTGGTTCCTTTAATAGTTAGAGTTCCTGACATAGCTTTTCCTCGTCTTAATAATATAAGGTTATGATTATTATTTCCTTCTTTAATTTTAATAATTACAAGAATATTTATTGATCAGGGGGCAGGGACTGGGTGAACGGTGTATCCTCCTTTATCTTTATCTATAAGGCATCCTGGTGTGGCACCTGATTTAGTAATTTTTTCTTTACATTTGAGGGGGGTATCTTCAATTTTAGGGGCAATTAATTTTATTACTACAATTATAAATATACGACCAAAAATAATATCTATAGATAAAATTTCTTTATTTGTTTGATCTATTTTTTTAACTACAATTTTACTTTTATTATCTTTACCTGTGTTAGCTGGAGGAATTACAATATTATTATTTGATCGTAATTTAAATACTTCTTTTTATGATCCWATTGGAGGGGGGGAWCCTATTTTGTATCARCATTTATTT- 3 ’.

Biology.

Habitat. Occurs in both open and forested localities with mushrooms and decaying plant matter. Found in spruce forests and alder forests, but also in coastal sand dunes. In Japan found mostly in domestic areas. Rarely collected with Malaise traps or by sweep netting.

Flight period. July to September, with a slight peak in August.

Hosts. Reared from Scaptomyza pallida and Drosophila quinaria species group: Drosophila kuntzei , D. limbata , D. phalerata and emerged together with these hosts in the Netherlands from decaying plant matter (cucumber bait) ( Hardy et al. 1992) and Heracleum mantegazzianum petioles, as well as from Agaricus bisporus (J. E. Lange) Imbach, 1946 (cultivated mushroom) ( van Dijken and van Alphen 1998). Also emerged from Fomitopsis pinicola (Sw.) P. Karst., 1881 (red-belted conk), where Leptopilina longipes probably was parasitoid of Leucophenga quinquemaculata Strobl, 1893 ( Jonsell et al. 1999). In Japan taken from Drosophila simulans , but also D. immigrans and the non-Western Palearctic D. auraria species complex and D. nigromaculata in banana bait ( Kimura 2015).

Ex situ reared from D. subobscura ( Eijs and van Alphen 1999) . Not found in fermenting apples ( van Dijken and van Alphen 1998).

Population parameters. While there are thelytokous populations in Japan ( Wachi et al. 2015), samples from Europe include males and females ( Nordlander 1980). Probably univoltine ( Hardy et al. 1992). In Japan, L. longipes overwinters in prepupal diapause (unpublished data in Kimura 2019). During probing, it holds the antennae remarkably straight and does not touch the substrate; efficient at finding hosts at low densities ( van Dijken and van Alphen 1998).

Distribution.

Restricted to the Palearctic; mainly northern and central Europe: found in Austria (locus typicus of Eucoila pusilla ), Bulgaria, Croatia, Czech Republic, Denmark, Finland, Georgia, Germany (locus typicus of Cothonaspis longipes ), Moldova (locus typicus of Rhoptromeris rutilus ), the Netherlands, Norway, Sweden, Switzerland, and the United Kingdom. Outside of Europe only known from Japan.

Remarks.

We sequenced two specimens of L. longipes from two localities. The currently available sequences on BOLD represent a single BIN “ BOLD: ACS 3295 ”. In DROP, two CO 1 sequences of L. longipes are available, both of which match with our sequences (<2 % difference), though one (voucher ID: 330) is listed as unidentified.

Figures

Figure 8. Female specimen of L. longipes (ZFMK - TIS- 2631095) A lateral habitus B left antenna C dorsal view on mesoscutellum D lateral view on metapleuron and base of metacoxa E posterior view on mesoscutellum and propodeum.