Leptopilina heterotoma (Thomson, 1862)

Vogel, Jonathan, Martin, Jakob, Forshage, Mattias, Salden, Tobias, Staverløkk, Arnstein, Verheyde, Fons, Nordlander, Göran, Herz, Annette & Peters, Ralph S., 2025, The Leptopilina Förster, 1869 of the Western Palearctic, and an updated list of the world species (Hymenoptera, Figitidae, Eucoilinae), Journal of Hymenoptera Research 98, pp. 915-969 : 915-969

Leptopilina heterotoma (Thomson, 1862)

Eucoila heterotoma Thomson, 1862: 403 .

Ganaspis subnuda Kieffer, 1904: 6 .

Ganaspis monilicornis Kieffer, 1904: 622–623 .

Erisphagia philippinensis Kieffer, 1916: 282 .

Pseudeucoila bochei Weld, 1944: 65–66 .

Diagnosis.

Leptopilina heterotoma is a size-variable species but on average large (frequently around 2 mm ♀ body length) with a robust appearance and medium-long antennae (Fig. 6 A ).

The species possesses a uniquely large mesoscutellar plate which is widest in its anterior half, making it rhombic in shape (Fig. 6 C ). However, the shape is varying slightly and can overlap with that of L. japonica and vice versa. The dorsal profile of the mesoscutellar plate usually appears s-shaped in L. heterotoma and is more evenly convex in L. japonica . The mesoscutellar plate is either more or less circular in L. fimbriata or less elongate drop-shaped in all other species.

The metapleural ridges 1 and 2 are reaching (or almost so) the anterior margin of the metapleuron (Fig. 6 E ), as in L. japonica . The ridges 1 and 2 of the other species, if present, reach at most to half the length of the metapleuron. The sculpture of the dorsal surface of the mesoscutellum is mediolaterally areolate. This is somewhat similar to the striae of L. boulardi , though the striae in L. heterotoma are more equally distributed along the mesoscutellar plate (Fig. 6 C ), while they are radiating from the base of the mesoscutellar plate in L. boulardi . The sculpture of all other species is usually foveate-reticulate. The base of the metacoxa has a setal patch (Fig. 6 E ), like most other species. Only L. japonica and L. boulardi have either no patch or at most a few singular setae.

L. heterotoma can be confused with small species of Trybliographa , which are similar and closely related but they have a full hairy ring and lack the petiolar rim.

Molecular characterisation.

Maximum intraspecific barcode-distance: 1.1 % (45).

Minimum interspecific barcode-distance: 11.7 % ( L. japonica ).

Consensus barcode sequence: 658 bp.

5 ’ - TATTATATATTTTATATTTGGAATTTGATCAGGGATAGTAGGGGCAGGGTTAAGGTTGATTGTTCGGATAGAGTTAGGTATACCAGGTCAATTAATTAATAATGATCAAATTTATAATTCTATTGTTACTGCTCATGCATTTATTATAATTTTTTTTATAGTTATACCAATTATAGTTGGAGGATTTGGGAATTATTTAATTCCATTAATACTTACAGTTCCTGATATAGCATTTCCACGTTTAAATAATATAAGTTTATGACTTTTATTTCCTTCTATGATTTTAATATTAGCAAGAATAATAATTGACCAAGGGGCAGGAACAGGATGAACTGTTTACCCTCCTTTATCTCTTAGAGATAGACATCCTGGGGTTTCAACTGATTTAGTAATTTTTTCATTACATTTAAGGGGGGTATCTTCAATTTTAGGGTCTATTAATTTTATTTCAACAATTATTAATATACGACCTTATTTAATATCAATAGATAAAATTACATTATTTGTTTGAGCAATTTTTTTAACAACTATTCTTTTATTGTTATCATTACCTGTTTTAGCAGGAGGAATTACAATATTATTATTTGATCGAAATTTAAATACTTCTTTTTATGATCCTGTTGGAGGAGGAGATCCAATTTTGTATCAACATTTATTT- 3 ’.

Biology.

Habitat. Occurs in both open and forested habitats (nemoral forest, meadows, gardens, orchards), but mainly localities with an abundance of fruit. Most commonly emerging from decaying fruit, less frequently from decaying plant materials, fungi, and tree sap bleed. Common in Malaise trap and sweep net samples.

Flight period. April to October in Europe but common only in July and August. Occurring throughout winter in Macaronesia.

Hosts. Generalist with a wide host range, predominantly in fruit-inhabiting Drosophila : Drosophila busckii , D. buzzatii Patterson & Wheeler, 1942 , D. funebris (Fabricius, 1787) , D. immigrans , D. kuntzei , D. melanogaster , D. obscura Fallén, 1823 , D. phalerata , D. simulans , D. subobscura , additionally, there are several hosts that are not present in the Western Palearctic: Drosophila americana Spencer, 1938 , D. bocqueti Tsacas & Lachaise, 1974 , D. malerkotliana Parshad & Paika, 1965 , D. teissieri , D. yakuba Burla, 1954 (rev. in Carton et al. 1986; Carton and Nappi 1991).

Also found in D. limbata in decaying plant materials ( Heracleum mantegazzianum ) ( Vet and van Alphen 1985; van Alphen et al. 1991). Present in sap bleed of Quercus robur L. and Acer pseudoplatanus L., but not of Hippophae rhamnoides L. ( Janssen et al. 1988). Low levels of parasitoidism in fungivorous hosts ( Phallus impudicus, Imleria badia ): Drosophila immigrans , D. kuntzei , D. phalerata , D. picta Zetterstedt, 1847 ( Janssen et al. 1988; Driessen et al. 1990; Poolman Simons et al. 1992).

Ex situ: Reared from D. bifasciata Pomini, 1940 ( Wachi et al. 2015), D. hydei Sturtevant, 1921 ( Xie et al. 2010), D. virilis , and Scaptomyza pallida ( Eijs and van Alphen 1999) and the non-Western Palearctic species D. nigromaculata Kikkawa & Peng, 1938 , D. orientacea Grimaldi, James & Jaenike, 1992 ( Wachi et al. 2015), D. erecta , D. eugracilis , D. lutescens Okada, 1975 , D. mauritiana , D. pseudoobscura , D. robusta Sturtevant, 1916 , D. santomea Lachaise & Harry, 2000 , D. sechellia , D. willistoni Sturtevant, 1916 , and Zaprionus vittiger Coquillett, 1901 ( Schlenke et al. 2007).

No successful development in D. suzukii ( Chabert et al. 2012) , because eggs get hemocytically encapsulated ( Poyet et al. 2013).

Population parameters. The most generalist Leptopilina species, predominant in northern France throughout the season and less frequent in the Mediterranean; it competes with L. boulardi where the geographical range overlaps and populations appear and peak before L. boulardi ( Fleury et al. 2004, 2009; Mazzetto et al. 2016). Hosts are attacked at random, but superparasitoidism is avoided and increases with parasitoid density ( van Alphen and Vet 1986). In cool temperate regions of Japan, female adults overwinter as a free-living adult while other stages and male adults die ( Kimura 2019). It is pro-ovigenic ( Vuarin et al. 2012) and infection with Wolbachia is possible ( Vavre et al. 2009).

Distribution.

Cosmopolitan species, widespread in the Western Palearctic: Austria, the Azores, Belgium, Bulgaria, the Canary Islands, Czech Republic, Finland, France (locus typicus of Ganaspis monilicornis ), Germany, Greece, Ireland, Israel, Italy, Madeira, the Netherlands, Norway, Slovenia, Spain, Sweden (locus typicus of Eucoila heterotoma ), Switzerland, Tunisia, Turkey, and the United Kingdom. In Eastern Palearctic: Japan; in North America: eastern USA (locus typicus of Pseudeucoila bochei ), and Canada; in tropical Asia: the Philippines (locus typicus of Erisphagia philippinensis ), in the Afrotropics: Democratic Republic of the Congo, Madagascar, and St Helena; and in Australia and Vanuatu.

Remarks.

A comprehensive review on L. heterotoma was recently published by Quicray et al. (2023).

While Novković et al. (2011) found high intra-specific genetic differences between the CO 1, ITS 1 and ITS 2 sequences of (a limited number of) Japanese specimens of L. heterotoma and specimens of a French laboratory strain, questioning whether they were the same species, we could not contribute to solving this issue as our material was exclusively from the Western Palearctic region.

We sequenced 45 specimens of L. heterotoma from 36 localities. The currently available sequences on BOLD represent a single BIN “ BOLD: ACB 8464 ”. Three sequences in DROP (voucher IDs 339, 864 and 817) cluster close together with L. heterotoma , but show a high difference (> 6 %) to the otherwise comparably homogenous L. heterotoma sequences, while two of them (339 and 864) are identified as L. heterotoma and the other one (817) as unidentified Leptopilina .

Figures

Figure 6. Female specimen of L. heterotoma (ZFMK - TIS- 2629375) A lateral habitus B left antenna C dorsal view on mesoscutellum D lateral view on metapleuron and base of metacoxa E posterior view on mesoscutellum and propodeum.