Curlevskiomycota Tedersoo, 2025
|
publication ID |
https://doi.org/10.3897/mycokeys.124.161674 |
|
DOI |
https://doi.org/10.5281/zenodo.17398858 |
|
persistent identifier |
https://treatment.plazi.org/id/8AA271D4-AAE9-52EF-B2B4-E3DDF66B55D9 |
|
treatment provided by |
|
|
scientific name |
Curlevskiomycota Tedersoo |
| status |
phyl. nov. |
Curlevskiomycota Tedersoo phyl. nov.
Type class.
Curlevskiomycetes Tedersoo.
Diagnosis.
Distinguishable from other fungi based on diagnostic nucleotide signatures in the LSU 5 ’ end (positions 52–73 in the type species and S. cerevisiae ccgaggaaaagaaactaacaag or tggaggaaaagaaaaaaacatt; no mismatch allowed). Forms a monophyletic, least inclusive clade in fungi, covering sequences EUK 1124408 , EUK 1103576 , MG 664460, EUK 1700038 , EUK 1700047 , EUK 1124407 , EUK 1631674 , EUK 1103826 , EUK 1103868 , EUK 1700102 , EUK 1603989 , EUK 1603990 , KF 849654, EUK 1103703 , EUK 1603986 , EUK 1602443 , EUK 1603988 , EUK 1124409 , and EUK 1630897 (Fig. 1 View Figure 1 ).
Notes.
Recognized based on eDNA sequences only. Encoded as clade GS 50 in EUKARYOME v 1.9. Currently harbors Curlevskiomycetes (class. nov.) and potentially several class-level groups represented by sequences EUK 1124408 (wetland soil in Estonia), EUK 1103576 (forest soil in Puerto Rico), MG 664460 (cropland soil in China), EUK 1700038 ( woodland soil in NT, Australia), EUK 1700047 (desert soil in Saudi Arabia), EUK 1124407 (wasteland soil in Estonia), and EUK 1631674 (forest soil in Estonia). Comprises potentially 100–120 species. Detected in soil (97.5 % out of the 163 records) and plant roots (1.8 %) in boreal forest to hot tropical biomes across all continents except Antarctica.
| MG |
Museum of Zoology |
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
|
Kingdom |
|
|
SubKingdom |
Mucoromycota |
|
Phylum |
