Leptopilina japonica Novković & Kimura, 2011

Vogel, Jonathan, Martin, Jakob, Forshage, Mattias, Salden, Tobias, Staverløkk, Arnstein, Verheyde, Fons, Nordlander, Göran, Herz, Annette & Peters, Ralph S., 2025, The Leptopilina Förster, 1869 of the Western Palearctic, and an updated list of the world species (Hymenoptera, Figitidae, Eucoilinae), Journal of Hymenoptera Research 98, pp. 915-969 : 915-969

Leptopilina japonica Novković & Kimura, 2011

Leptopilina japonica japonica Novković & Kimura, 2011: 341–343.

Diagnosis.

Leptopilina japonica is a large species (usually around 2 mm ♀ body length) with a robust appearance and medium-long antennae (Fig. 7 A ).

The species is, together with L. boulardi , characteristic in having at most a few singular setae on the base of the metacoxa instead of a distinct setal patch (Fig. 7 D ), which is typical for all other species. Leptopilina japonica differs from L. boulardi by the distinct metapleural ridges 1 and 2 that almost reach the anterior metapleural margin (Fig. 7 D ). The extension of the ridges 1 and 2 is shared with L. heterotoma , while all other species have significantly shorter or no ridges. The mesoscutellar plate is similar in shape to that of L. heterotoma , being more elongate than those of the other species, but L. heterotoma has a typically rhombic mesoscutellar plate, while it is more drop-shaped, being widest in the posterior half, in L. japonica (Fig. 7 C ). The shape is however rather variable and may overlap between the two species. The lateral view of the mesoscutellar plate usually appears s-shaped in L. heterotoma and is more evenly convex in L. japonica . The sculpture of the dorsal surface of the mesoscutellum is mediolaterally foveate-reticulate, as in most other species (Fig. 7 C ). Only L. boulardi and L. heterotoma are areolate instead. The mesoscutellar surface sometimes has additional concentric striae (as in Fig. 7 C ).

Molecular characterisation.

Maximum intraspecific barcode-distance: 0.6 % (6).

Minimum interspecific barcode-distance: 11 % ( L. heterotoma ).

Consensus barcode sequence: 658 bp.

5 ’ - TGTAATGTATTTTGTTTTTGGTATTTGGTCTGGGATAGTGGGGGCTGGGTTAAGATTCCTTGTTCGTACAGAATTAGGGATACCTGGGCAGTTGATTAATAATGATCAAATTTATAATTCAATTGTAACTGCTCATGCTTTTGTTATAATTTTTTTTATAGTGATACCAATTATGGTTGGGGGGTTTGGCAATTATTTAGTACCATTAATATTAACTGTTCCTGACATAGCTTTCCCTCGATTGAATAATATAAGATTATGATTATTATTTCCTTCAATGATTTTAATGGTGGCAAGGATGATAATTGATCAAGGGGCAGGGACAGGGTGAACGGTTTATCCTCCTTTATCTTTAATAGATAGTCATCCTGGGGTTTCTACTGATTTAGTAATTTTTTCATTACATTTAAGAGGGGTATCTTCGATTTTAGGGTCAATTAATTTTATTTCTACTATTATTAATATACGTCCTTATTTAATAACAATAGATAAAATTACTTTATTTATTTGAGCTATTTTTTTAACAACAATTCTTTTATTATTATCTTTACCTGTTTTAGCAGGGGGGATTACTATATTATTATTTGATCGTAATTTAAATACTTCTTTTTATGATCCTGTTGGAGGGGGGGACCCAATTTTGTATCAACATTTATTT- 3 ’.

Biology.

Habitat. Outside of the native range in East Asia, mostly found in orchards, parks, residential areas, and forests, if they contain suitable plants for D. suzukii , in the native range found in forests. Common in Malaise trap and sweep net samples.

Flight period. In Europe, from May to November, but most abundant in late summer.

Host. In the native range, L. japonica has been reared from Drosophila suzukii ( Daane et al. 2016) and the non-Western Palearctic hosts D. biauraria Bock & Wheeler, 1972 , and D. rufa Kikkawa & Peng, 1938 ( Novković et al. 2011).

Ex situ, it has also been reared from D. bifasciata , D. busckii , D. funebris , D. immigrans , D. melanogaster , D. simulans , and D. subobscura ( Novković et al. 2011; Kimura and Novković 2015; Girod et al. 2018 a; Daane et al. 2021) and the non-Western Palearctic hosts D. auraria Peng, 1937 , D. sp. aff. bicornuta Bock & Wheeler, 1972, D. bipectinata Duda, 1923 , D. bocki Baimai, 1979 , D. lutescens , D. montana Patterson & Wheeler, 1942 , D. orientacea , D. persimilis Dobzhansky & Epling, 1944 , D. pseudoobscura , D. robusta , D. sulfurigaster (Duda, 1923) , D. takahashii Sturtevant, 1927 , and Hirtodrosophila duncani (Sturtevant, 1918) , but with very mixed success rates ( Kimura and Novković 2015; Daane et al. 2021). Another three species were attacked with no parasitoid emergence ( Kimura and Novković 2015). Parasitoidism success may depend on the geographic origin of parasitoid or host ( Kimura and Novković 2015; Girod et al. 2018 a).

Unlike native Leptopilina species from the Western Palearctic, L. japonica can overcome the immune response of D. suzukii ( Chabert et al. 2012) . While it has also been collected together with closely related Drosophila , L. japonica is associated with D. suzukii in the native ranges ( Girod et al. 2018 b; Matsuura et al. 2018) and in the non-native ranges. In North America, in situ parasitoidism of the Drosophila obscura species group and the D. melanogaster species group has been observed (Paul K. Abram personal communication). As a result of the close association with D. suzukii in the Western Palearctic, L. japonica has mostly been found in habitats with fruiting plants that host D. suzukii ( Abram et al. 2022; Gariepy et al. 2024; Rossi-Stacconi et al. 2025).

Population parameters. Moderately pro-ovigenic ( Wang et al. 2018), no Wolbachia infection is known ( Wachi et al. 2015). Forming multiple generations per season ( Rossi-Stacconi et al. 2025).

Distribution.

Non-native species in the Western Palearctic, originally from East Asia. In Europe since 2019: present in Belgium (since 2022, new record), France (since 2022, Rousse et al. 2023), Germany (since 2021, Martin et al. 2023), Italy (since 2019, Puppato et al. 2020), Switzerland (since 2021, Rossi-Stacconi et al. 2025), and the United Kingdom (since 2024, Powell et al. 2025). In Asia present in China ( Daane et al. 2016), Japan ( Novković et al. 2011), and South Korea ( Giorgini et al. 2019). It has spread to Canada since 2016 ( Abram et al. 2020) and to the USA since 2020 ( Beers et al. 2022). Records in 2023 and 2024 from Northern Germany in the state of Brandenburg represent the globally northernmost detections of this species so far ( Rossi-Stacconi et al. 2025).

Remarks.

A comprehensive review on L. japonica was recently published by Rossi-Stacconi et al. (2025).

In their original description, Novković & Kimura separated L. japonica into two subspecies: the subtropical Leptopilina japonica formosana Novković & Kimura, 2011 , found in Taiwan, and the temperate Leptopilina japonica japonica Novković & Kimura, 2011 , found in Japan ( Novković et al. 2011; Murata et al. 2013). In accordance with the respective climatic preferences reported by Murata et al. (2013), populations in Europe and North America have been identified to belong to L. j. japonica ( Gariepy et al. 2024; Rossi-Stacconi et al. 2025). In this publication, we exlusively refer to L. j. japonica when we write L. japonica . Novković et al. (2011) describe the separation of the subspecies as challenging, as the described diagnostic differences consist only of the darker antenna and a narrower and elongated mesoscutellar plate of L. j. formosana compared to L. j. japonica . However, the subspecies are in need of taxonomic re-evaluation and will likely be elevated to species-rank based on genetic and morphological data (Ionela-Madalina Viciriuc and Matthew L. Buffington pers. comm.).

The data provided here contain two hitherto unpublished records of L. japonica collected in 2022, one from Bonn ( Germany, ZFMK -TIS-2637732 ) and the other collected in Ypres ( Belgium, ZFMK -TIS-2637792 ). The latter represents a new country record and is, together with the recently published record from the United Kingdom ( Powell et al. 2025), another indicator of the rapid spread of L. japonica within Europe.

The absence of the setal patch on the metacoxal base is a previously unrecognised character that is consistent in both males and females throughout our material and that from the Nearctic (Matt Buffington and Paul K. Abram pers. Comm.). This character, only shared with the otherwise quite distinct L. boulardi , facilitates the diagnosis of L. japonica substantially.

We sequenced six specimens of L. japonica from two localities. On BOLD, sequences of 499 specimens are recorded, forming three BINs. Our sequences are assigned to the BIN “ BOLD: ACD 4002 ” only. The specimens behind the other two BINs require further taxonomic evaluation.

Figures

Figure 7. Female specimen of L. japonica (ZFMK - TIS- 2632471) A lateral habitus B left antenna C dorsal view on mesoscutellum D lateral view on metapleuron and base of metacoxa E posterior view on mesoscutellum and propodeum.