Phronia elegantula Hackman, 1970

Salmela, Jukka & Kolcsar, Levente-Peter, 2017, New and poorly known Palaearctic fungus gnats (Diptera, Sciaroidea), Biodiversity Data Journal 5, pp. 11760-11760 : 11760

Phronia elegantula Hackman, 1970

Phronia elegantula Hackman 1970: 43 (figs. 10-13), description

Materials

Type status: Holotype. Occurrence: recordedBy: A.V.V. Mikkola; individualCount: 1; sex: male; Location: country: Finland; stateProvince: Ostrobothnia kajanensis; verbatimLocality: Sotkamo, Aarreniemi; Identification: identifiedBy: W. Hackman; Event: eventDate: 1964-8-11; Record Level: institutionCode: MZHF Type status: Paratype. Occurrence: recordedBy: R. Tuomikoski, K. Mikkola; individualCount: 1; sex: male; Location: country: Finland; stateProvince: Regio kuusamoensis; verbatimLocality: Kuusamo, Juuma, Jäkälävuoma; Identification: identifiedBy: W. Hackman; Event: eventDate: 1964-8-21; Record Level: institutionCode: MZHF Type status: Other material. Occurrence: catalogNumber: DIPT-JS-2016-0166 ; recordedBy: J. Salmela; individualCount: 1; sex: male; Location: country: Finland; stateProvince: Lapponia kemensis pars orientalis; verbatimLocality: Pelkosenniemi, Luiron suot Mire Conservation Area, Sudenvaaranaapa; verbatimLatitude: 67.1900; verbatimLongitude: 27.6352; verbatimCoordinateSystem: decimal degrees; verbatimSRS: WGS84; Identification: identifiedBy: J. Salmela; Event: samplingProtocol: Malaise trap; eventDate: 2015-7-31 /9-29; habitat: rich birch fen; Record Level: institutionCode: JES Type status: Other material. Occurrence: catalogNumber: DIPT-JS-2016-0167 ; recordedBy: J. Salmela; individualCount: 1; sex: male; Location: country: Finland; stateProvince: Lapponia kemensis pars orientalis; verbatimLocality: Pelkosenniemi, Luiron suot Mire Conservation Area, Sudenvaaranaapa; verbatimLatitude: 67.1900; verbatimLongitude: 27.6352; verbatimCoordinateSystem: decimal degrees; verbatimSRS: WGS84; Identification: identifiedBy: J. Salmela; Event: samplingProtocol: Malaise trap; eventDate: 2015-7-31 /9-29; habitat: rich birch fen; Record Level: institutionCode: JES Type status: Other material. Occurrence: catalogNumber: NHMO_MYC00025 ; recordedBy: L.O. Hansen; individualCount: 1; sex: male; Location: country: Norway; stateProvince: Buskerud; verbatimLocality: Kongsberg, Skollenborg, Labro; verbatimLatitude: 59.6184; verbatimLongitude: 9.6774; verbatimCoordinateSystem: decimal degrees; verbatimSRS: WGS84; Identification: identifiedBy: J. Salmela; Event: samplingProtocol: sweep net; eventDate: 2008-9-28; Record Level: institutionCode: NHMO Type status: Other material. Occurrence: catalogNumber: NHMO_MYC00026 ; recordedBy: L.O. Hansen; individualCount: 1; sex: male; Location: country: Norway; stateProvince: Buskerud; verbatimLocality: Kongsberg, Skollenborg, Labro; verbatimLatitude: 59.6184; verbatimLongitude: 9.6774; verbatimCoordinateSystem: decimal degrees; verbatimSRS: WGS84; Identification: identifiedBy: J. Salmela; Event: samplingProtocol: sweep net; eventDate: 2008-9-28; Record Level: institutionCode: NHMO Type status: Other material. Occurrence: catalogNumber: BIOUG08254-E11 ; recordedBy: G. Sellmayer; individualCount: 1; sex: male; Location: country: Germany; stateProvince: Bavaria; verbatimLocality: Nationalpark Bayerischer Wald, 11.3 km N of Grafenau; verbatimElevation: 842 m; verbatimLatitude: 48.950; verbatimLongitude: 13.421; verbatimCoordinateSystem: decimal degrees; verbatimSRS: WGS84; Identification: identifiedBy: J. Salmela; Event: samplingProtocol: Malaise trap; eventDate: 2012-8-25 /9-3; habitat: conifer-dominated mountain forest; Record Level: institutionCode: ZSM Type status: Other material. Occurrence: catalogNumber: BIOUG08259-G06 ; recordedBy: G. Sellmayer; individualCount: 1; sex: male; Location: country: Germany; stateProvince: Bavaria; verbatimLocality: Nationalpark Bayerischer Wald, 11.3 km N of Grafenau; verbatimElevation: 842 m; verbatimLatitude: 48.950; verbatimLongitude: 13.421; verbatimCoordinateSystem: decimal degrees; verbatimSRS: WGS84; Identification: identifiedBy: J. Salmela; Event: samplingProtocol: Malaise trap; eventDate: 2012-8-25 /9-3; habitat: conifer-dominated mountain forest; Record Level: institutionCode: ZSM Type status: Other material. Occurrence: catalogNumber: BIOUG08318-G10 ; recordedBy: G. Sellmayer; individualCount: 1; sex: female; Location: country: Germany; stateProvince: Bavaria; verbatimLocality: Nationalpark Bayerischer Wald, 11.3 km N of Grafenau; verbatimElevation: 842 m; verbatimLatitude: 48.950; verbatimLongitude: 13.421; verbatimCoordinateSystem: decimal degrees; verbatimSRS: WGS84; Identification: identifiedBy: J. Salmela; Event: samplingProtocol: Malaise trap; eventDate: 2012-8-25 /9-3; habitat: conifer-dominated mountain forest; Record Level: institutionCode: ZSM Type status: Other material. Occurrence: catalogNumber: BIOUG08251-F07 ; recordedBy: G. Sellmayer; individualCount: 1; sex: female; Location: country: Germany; stateProvince: Bavaria; verbatimLocality: Nationalpark Bayerischer Wald, 11.3 km N of Grafenau; verbatimElevation: 842 m; verbatimLatitude: 48.950; verbatimLongitude: 13.421; verbatimCoordinateSystem: decimal degrees; verbatimSRS: WGS84; Identification: identifiedBy: J. Salmela; Event: samplingProtocol: Malaise trap; eventDate: 2012-8-25 /9-3; habitat: conifer-dominated mountain forest; Record Level: institutionCode: ZSM Type status: Other material. Occurrence: catalogNumber: BIOUG08217-B09 ; recordedBy: G. Sellmayer; individualCount: 1; sex: female; Location: country: Germany; stateProvince: Bavaria; verbatimLocality: Nationalpark Bayerischer Wald, 11.3 km N of Grafenau; verbatimElevation: 842 m; verbatimLatitude: 48.950; verbatimLongitude: 13.421; verbatimCoordinateSystem: decimal degrees; verbatimSRS: WGS84; Identification: identifiedBy: J. Salmela; Event: samplingProtocol: Malaise trap; eventDate: 2012-8-25 /9-3; habitat: conifer-dominated mountain forest; Record Level: institutionCode: ZSM Type status: Other material. Occurrence: catalogNumber: BIOUG08218-G07 ; recordedBy: G. Sellmayer; individualCount: 1; sex: female; Location: country: Germany; stateProvince: Bavaria; verbatimLocality: Nationalpark Bayerischer Wald, 11.3 km N of Grafenau; verbatimElevation: 842 m; verbatimLatitude: 48.950; verbatimLongitude: 13.421; verbatimCoordinateSystem: decimal degrees; verbatimSRS: WGS84; Identification: identifiedBy: J. Salmela; Event: samplingProtocol: Malaise trap; eventDate: 2012-8-25 /9-3; habitat: conifer-dominated mountain forest; Record Level: institutionCode: ZSM Type status: Other material. Occurrence: catalogNumber: BIOUG08217-C03 ; recordedBy: G. Sellmayer; individualCount: 1; sex: female; Location: country: Germany; stateProvince: Bavaria; verbatimLocality: Nationalpark Bayerischer Wald, 11.3 km N of Grafenau; verbatimElevation: 842 m; verbatimLatitude: 48.950; verbatimLongitude: 13.421; verbatimCoordinateSystem: decimal degrees; verbatimSRS: WGS84; Identification: identifiedBy: J. Salmela; Event: samplingProtocol: Malaise trap; eventDate: 2012-8-25 /9-3; habitat: conifer-dominated mountain forest; Record Level: institutionCode: ZSM Type status: Other material. Occurrence: catalogNumber: BIOUG08211-A12 ; recordedBy: G. Sellmayer; individualCount: 1; sex: female; Location: country: Germany; stateProvince: Bavaria; verbatimLocality: Nationalpark Bayerischer Wald, 11.3 km N of Grafenau; verbatimElevation: 842 m; verbatimLatitude: 48.950; verbatimLongitude: 13.421; verbatimCoordinateSystem: decimal degrees; verbatimSRS: WGS84; Identification: identifiedBy: J. Salmela; Event: samplingProtocol: Malaise trap; eventDate: 2012-8-2 /12; habitat: conifer-dominated mountain forest; Record Level: institutionCode: ZSM

Description

Male. Head dark-brown, vertex covered by dark setae, frons glabrous and face anteriorly with small setae. Ocelli arranged in a line, central ocellus smaller than laterals; lateral ocelli close to eyes, their distance from eye less than their own width. Eyes pubescent. Palpi yellowish-brown, bearing light setae. Length ratio of palpal segments 3-5: 3:4=0.98, 4:5=0.59. Penultimate segment 2.94 times as long as wide, last segment 8.2 times as long as wide. Third palpomere with a sensory pit in its base. Antennae brown, 16-segmented (scape, pedicel and 14 flagellomeres); scape, pedicel and basal half of first flagellomere yellowish. Scape with a prominent dorsal seta, about as long as first flagellomere. Scape:pedicel length ratio 1.33. Flagellomeres cylindrical, length:width ratio of 1st flagellomere 2.98, 4th flagellomere 1.75 and apical flagellomere 2.95. Flagellomeres covered by dense light setosity, setae slightly curved, their length shorter than width of respective flagellomere.

Thorax generally brown. Scutum dorsally with three dark stripes, that are almost confluent; the stripes are separated by very narrow yellowish gaps; anterolateral corners yellowish. Scutum with mainly pale setosity. Mediotergite bare, other sclerites bearing setae. Scutellum with four stout setae. Halteres pale, bearing weak light setae and setulae.

Wings hyaline, veins light brown. Bases of M1 and M2, M1+2, r-m, bM1+2, base of Rs and apex of Sc bare, other veins setose. C very slightly exceeding tip of R5. Sc ending free. Length ratio of M1+2:r-m = 1.29. Wing length 2.2 mm.

Coxae and legs yellow, apices of mid and hind femora sligthly infuscated, bearing dark setae. Length ratio of femur to tibia for fore, mid and hind legs: 0.99, 0.97, 0.79. Length ratio of tibia to basitarsus for fore, mid and hind legs: 1.08, 0.97, 0.8. Anteroapical depressed area of the fore tibia ovate, having ca. 20 light in a row. Ratio of apical width of tibia:length of longest tibial spur for fore, mid and hind legs: 0.35, 0.28, 0.25.

Abdomen mostly dark brown, but first, second and third tergites caudolaterally yellowish; these yellow areas are most extensive in second and third tergite. Sternum of second and third segments yellowish. Hypopygium dark brown. Ventroapical margin of gonocoxite with a wide and shallow median emargination, with a moderate median peak (Fig. 17b). Ventral lobe of gonostylus widest basally, rounded (Fig. 17a, c). Dorsal lobe of gonostylus rounded, widest subapically, having ca. 20 stout apical setae and four subapical setae that are thinner that apical setae (Fig. 17a, c). Mesial portion of gonostylus having a transversal, setose basal projection and above that two projections; the other one is simple and elongated, apically rounded, the other one is intricate, terminating into long and narrow projection (Fig. 17c). Inner lamina of the ventral lobe of gonostylus with medial a tuft of ca. eight setae, projecting perpendicularly from the lamina. Inner lamina basally, close to the edge of the stylus, with a larger group of setae. Comb-like structures are absent. Aedeagal complex rounded, length:width ratio 0.96. Aedeagal complex with a longitudinal sclerotised rod, that is basally divided into two apodemes and is apically anchor-shaped (Fig. 17d).

Female. Similar to male. Antennae dark except scape, pedicel and base of 1st flagellomere yellowish brown. Scape:pedicel length ratio 1.32. Length:width ratio of 1st flagellomere 3.9, 4th flagellomere 2.80, apical flagellomere 2.5. Length ratio of M1+2:r-m = 1.84. Wing length 2.2 mm.

Diagnosis

A Phronia species with a yellowish pattern on the abdominal tergites 1-3. The ventral lobe of the gonostylus is rounded and at its widest basally. The mesial projections are finger-like and the inner lamella of the ventral lobe of the gonostylus bears a tuft of setae. The species is somewhat close to P. elegans Dziedzicki and P. signata Winnertz, that have similarly shaped ventral lobe of the gonostylus; P. elegantula can be distinguished from these due to differences in the structure of the aedeagus, the ventral lobe of gonostylus and the mesial portion of the gonostylus.

Distribution

A European species. The species was described from eastern Finland (Ok: Sotkamo and Ks: Kuusamo) and has been later recorded from southern and northern parts of the country (J. Jakovlev, unpublished). The species has been found from Russian Karelia ( Polevoi 2000) and Murmansk region ( Polevoi 2010). It has a wide range in Sweden ( Kjærandsen et al. 2007) and it has been once recorded from Germany, Bavaria ( Plassmann 1980). The species is reported here for the first time from Norway; it may have a boreo-alpine disjunct range.

Ecology

Sampling sites are coniferous forests, mixed forests and wetlands.

Taxon discussion

Phronia elegantula is somewhat similar to P. signata and P. elegans , and has the same yellowish anterolateral corners to the scutum as well as a rotund ventral lobe of the gonostylus. However the abdomen of P. elegans is dark brown as opposed to some yellowish colouration on abdominal tergites 1-3 of P. elegantula . Phronia signata have only moderately emarginated ventroapical margins of the gonocoxites, whereas this character is much more conspicuous in P. elegantula . Phronia signata has ca. 14 setae on the ventral edge of the ventral lobe of gonostylus (see e.g. Dziedzicki 1889, fig. 8 and Zaitzev 2003, fig. 91.4), in P. elegantula these setae are absent.

DNA barcoding

BOLD Sample ID: DIPT-JS-2016-0166. BOLD Process ID: SCFI751-16. GenBank accession number: KY200862. BOLD Sample ID: DIPT-JS-2016-0167. BOLD Process ID: SCFI752-16. GenBank accession number: KY200863. The sequence provided here is from DIPT-JS-2016-0166.

TATTTTATATTTCATTTTTGGTGCTTGATCTGGTATAGTAGGTACTTCTTTAAGAATCATTATTCGAACAGAATTAGGACACCCTGGAGCCTTAATTGGAAATGATCAAATTTATAATGTTATTGTTACTGCTCACGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTCGGTAATTGATTAGTTCCACTAATATTAGGAGCTCCAGATATAGCTTTCCCTCGAATAAATAATATAAGTTTTTGACTTTTACCACCATCTTTAACCTTATTACTTTCTAGTAGCTTAGTAGAAGCAGGGGCTGGAACAGGATGAACTGTTTATCCCCCTTTATCATCTACAATTGCCCATGCAGGAGCCTCAGTTGATTTAGCTATCTTTTCTTTACATTTAGCAGGTATTTCTTCTATTTTAGGAGCAGTAAATTTTATTACAACAATTATTAATATACGGGCCCCAGGAATTACTTTTGACCGAATACCATTATTTGTTTGATCGGTATTAATTACAGCAGTTCTTCTATTACTTTCTCTACCAGTTTTAGCTGGAGCTATTACTATATTATTAACAGATCGAAATTTAAATACCTCATTTTTTGACCCTGCCGGAGGAGGAGATCCCATTTTATATCAACACTTATTT

All studied specimens belong to the BIN BOLD:ACJ2889, and their similarities range between 99.69 and 98.78 (average 99.46). The nearest specimens in BOLD database belong to P. disgrega Dziedzicki, being 90.98 % similar to P. elegantula . DNA barcode and associated data of the German paratypes and female specimens is available from the BOLD Public data portal.