Ruua coralieae Tedersoo, 2024
|
publication ID |
https://doi.org/10.3897/mycokeys.107.125549 |
|
DOI |
https://doi.org/10.5281/zenodo.13286575 |
|
persistent identifier |
https://treatment.plazi.org/id/857DC242-41B5-5BCD-9ACA-B042FC3E784D |
|
treatment provided by |
|
|
scientific name |
Ruua coralieae Tedersoo |
| status |
sp. nov. |
Ruua coralieae Tedersoo sp. nov.
Diagnosis.
Separation from other species of Ruua based on the ITS region (positions 217–243 gaaaaaaaaagaaaggaaagaaaaggt; one mismatch allowed) and LSU (positions 470–489 tagtgcacttgctttcgcac; no mismatch allowed) as indicated in Fig. 15 View Figure 15 .
Type.
eDNA sample TUE 101598 ( holotype); eDNA sequence EUK 1603424 ; GSMc plot G 4464, Quercus robur forest (soil sample TUE 101598 ) in Ruu , Estonia, 59.45059 ° N, 25.22166 ° E GoogleMaps .
Description.
Other sequences: EUK 1602853 and EUK 1600135 (type locality); EUK 1604050 ( GSMc plot G 5002, Tilia - Quercus forest soil in Naissaar, Estonia, 59.57530 ° N, 24.53590 ° E); and EUK 1604051 ( GSMc plot S 480, Populus - Picea forest soil in Käru, Estonia, 58.80407 ° N, 25.22249 ° E).
Etymology.
Ruu (Estonian) refers to type locality; and Coralie (French) refers to the first name of Coralie Damon, who collected the first materials belonging to this genus.
Notes.
Found from three sites in Estonia, with ITS and LSU sequences displaying up to 0.3 % differences.
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
|
Kingdom |
|
|
Phylum |
|
|
Class |
|
|
Order |
|
|
Family |
|
|
Genus |
