Leptopilina fimbriata (Kieffer, 1901)

Vogel, Jonathan, Martin, Jakob, Forshage, Mattias, Salden, Tobias, Staverløkk, Arnstein, Verheyde, Fons, Nordlander, Göran, Herz, Annette & Peters, Ralph S., 2025, The Leptopilina Förster, 1869 of the Western Palearctic, and an updated list of the world species (Hymenoptera, Figitidae, Eucoilinae), Journal of Hymenoptera Research 98, pp. 915-969 : 915-969

publication ID

https://doi.org/10.3897/jhr.98.165583

publication LSID

lsid:zoobank.org:pub:E9A78FC5-6B58-4565-86EB-098C72908514

DOI

https://doi.org/10.5281/zenodo.17436390

persistent identifier

https://treatment.plazi.org/id/74160433-797A-517D-AED5-4382B5904E0B

treatment provided by

Journal of Hymenoptera Research by Pensoft

scientific name

Leptopilina fimbriata (Kieffer, 1901)
status

 

Leptopilina fimbriata (Kieffer, 1901)

Erisphagia longipes Cameron, 1883: 371 .

Eucoela ( Eucoela) fimbriata Kieffer, 1901: 174 .

Psilosema ( Erisphagia) xanthopum Kieffer, 1904: 605 .

Psilosema ( Erisphagia) filicorne Kieffer, 1904: 606–607 .

Psilosema longicornis Kieffer, 1907: 619 .

Episoda dolichocera Hellén, 1960: 19–20.

Diagnosis.

Leptopilina fimbriata is a small to medium-sized species (up to 1.6 mm ♀ body length) with slender appearance and remarkably long and filiform antennae in both sexes reaching more than 1.0 times the body length in females and more than 1.9 times the body length in males (Fig. 5 A View Figure 5 ). The metasoma is significantly paler than head and mesosoma, a pattern similar as in L. longipes , but more distinct. Also, the legs are strikingly stramineous (Fig. 5 A View Figure 5 ), while they are generally darker (brownish to reddish) in all other species.

Additionally, the mesoscutellar plate is usually notably circular and short in dorsal view (Fig. 5 C View Figure 5 ), and elevated and strongly sloping posteriorly in lateral view (Fig. 5 A View Figure 5 ). Other species possess either a rhombic ( L. heterotoma ) or drop-shaped (all other species), not notably short or elevated mesoscutellar plate, only slightly sloping posteriorly in L. longipes .

The metapleural ridge 1 is shorter than half the length of the metapleuron (Fig. 5 D View Figure 5 ) as in L. australis and L. clavipes . In other species, ridge 1 is at least half as long as the metapleuron, if present at all. The metapleural ridge 2 is shorter than half the length of the metapleuron (Fig. 5 D View Figure 5 ), as in L. australis , L. boulardi , and L. clavipes . In other species, ridge 2 is at least half as long as the metapleuron. The forewing is long with a narrow marginal cell. The forewing vein Rs is clearly longer than 2 r, and the accessory veins (M, Rs + M CU 1 and CU 1 a) are usually very distinct (Fig. 12 B View Figure 12 ), while they are faint or absent in other species.

Superficially, L. fimbriata is quite similar to Ganaspis seticornis Hellén, 1960 . This is another eucoiline species from a genus potentially associated with Drosophila and the most slenderly built European species in that genus. However, these genera are not closely related. Ganaspis is having far more of a hairy ring, less of a petiolar rim, a long row of setae on the metacoxae, and modified F 1 instead of F 2 in the male antenna.

Molecular characterisation.

Maximum intraspecific barcode-distance: 1.4 % (37).

Minimum interspecific barcode-distance: 13.0 % ( L. japonica ).

Consensus barcode sequence: 658 bp.

5 ’ - AGTTATATATTTTATTTTTGGGATTTGATCTGGGATAGTGGGGGCGAGATTGAGGATAATTATTCGTATAGAATTGGGGATACCGGGGCAGTTAATTAATAATGATCAAGTTTATAATACTATTGTTACGGCTCATGCATTTATTATAATTTTTTTTATAGTGATACCTATTATAGTTGGTGGGTTTGGGAACTATTTAATTCCTTTAATAATTACAGTTCCTGATATGGCGTTTCCTCGATTAAATAATATAAGATTATGACTTTTATTTCCTTCTTTATTTTTAATGTTAGCTAGAATATTTATTGATCAGGGGGCCGGGACAGGATGAACTGTTTATCCCCCTTTATCTTTAAGAATTGGGCATCCGGGGGTTTCTGTTGATTTAGTGATTTTTTCGTTACATTTAAGGGGGGTTTCTTCTATTTTGGGGTCAATTAATTTTATTTCTACTATTTTAAATGTTCGTCCAAATTTAATAATAATGGATAAAGTTACTTTATTTATTTGGTCTATTTTTTTAACAACTATTTTATTACTGTTATCTTTACCGGTATTAGCTGGGGGGATTACAATATTATTATTTGATCGTAATTTAAATACTTCTTTTTATGATCCTGTGGGAGGGGGGGATCCAATTTTGTATCAACATTTATTT- 3 ’.

Biology.

Habitat. Occurs in open and forested sites, as long as there is a layer of leaf litter, but preferrably in structure- and nutrient-rich and more or less damp habitats (e. g. lush garden, alluvial forest, spruce forest, beech forest, young aspen forest, open oak forest, abandoned meadow, shrubby meadow, open sandy pine forest, manure heap in open farmland, calcareous fen, reedbed). Emerged from decaying plant matter (e. g. beet leaves) and Heracleum mantegazzianum . Common in Malaise trap and sweep net samples.

Flight period. In Europe, from May to late September, but spring records are sparse and there is a peak in July and August. In Macaronesia also occurring throughout winter.

Hosts. Specialist which has only been found to parasitise Scaptomyza pallida ( van Alphen and Vet 1986, no specifics mentioned on the methodology, but seemingly an in situ observation) and Drosophila subobscura (van Alphen & Vet pers comm. in Carton et al. 1986).

Distribution.

Palearctic species. Present in Austria, Belgium, the Canary Islands, Czech Republic, Denmark, Estonia, Finland (locus typicus of Episoda dolichocera ), France (locus typicus of Eucoela fimbriata , Psilosema xanthopum , Psilosema filicorne and Psilosema longicornis ), Georgia, Germany, Greece, Italy, Lithuania, Madeira, the Netherlands, Norway, Poland, Portugal, Russia, Slovenia, Spain (locus typicus of Erisphagia longipes ), Sweden, Switzerland, Ukraine, and the United Kingdom. Further East, the species was also recorded from Kyrgysztan and China (BOLD). The published record from the Afrotropical region ( van Noort et al. 2015) may be a mistake and requires substantiation.

Remarks.

The first available name for this species is Erisphagia longipes Cameron, 1883 . However, after moving it to Leptopilina , it became a junior homonym of L. longipes (Hartig, 1841) ( Nordlander, 1980) . Leptopilina fimbriata (Kieffer, 1901) , as the second-oldest name, thereby serves as the valid name.

We sequenced 37 specimens of L. fimbriata from 11 localities. On BOLD, this species is represented by a single BIN: “ BOLD: ACO 1262 ”. Our CO 1 sequences are the first representatives of L. fimbriata in DROP.

Kingdom

Animalia

Phylum

Arthropoda

Class

Insecta

Order

Hymenoptera

SuperFamily

Cynipoidea

Family

Figitidae

SubFamily

Eucoilinae

Genus

Leptopilina

Loc

Leptopilina fimbriata (Kieffer, 1901)

Vogel, Jonathan, Martin, Jakob, Forshage, Mattias, Salden, Tobias, Staverløkk, Arnstein, Verheyde, Fons, Nordlander, Göran, Herz, Annette & Peters, Ralph S. 2025
2025
Loc

Episoda dolichocera Hellén, 1960: 19–20 .

Hellén W 1960: 20
1960
Loc

Erisphagia longipes

Erisphagia longipes Cameron, 1883: 371 .
Loc

Eucoela ( Eucoela ) fimbriata

Eucoela ( Eucoela ) fimbriata Kieffer, 1901: 174 .
Loc

Psilosema ( Erisphagia ) xanthopum

Psilosema ( Erisphagia ) xanthopum Kieffer, 1904: 605 .
Loc

Psilosema ( Erisphagia ) filicorne

Psilosema ( Erisphagia ) filicorne Kieffer, 1904: 606–607 .
Loc

Psilosema longicornis

Psilosema longicornis Kieffer, 1907: 619 .