Bryophila Treitschke, 1825

Korb, Stanislav K., 2020, A review of genera Cryphia Hübner, 1818 and Bryophila Treitschke, 1825 within the mountainous Central Asia: a case of too many poorly described species (Lepidoptera: Noctuidae), Zootaxa 4859 (4), pp. 545-595 : 551-584

publication ID

https://doi.org/ 10.11646/zootaxa.4859.4.6

publication LSID

lsid:zoobank.org:pub:595B4F35-0ECA-4DE1-8165-3C739BCEF230

DOI

https://doi.org/10.5281/zenodo.4536167

persistent identifier

https://treatment.plazi.org/id/5F3787E4-FFB0-A012-82BE-FBD3718E4FAD

treatment provided by

Plazi

scientific name

Bryophila Treitschke, 1825
status

 

Genus Bryophila Treitschke, 1825 View in CoL

Bryophila plumbeola Staudinger, 1881

Redescription (pl. 1, 2). Forewing length 12–18 mm. Wing upperside ground color vary from almost pure red to very dark brown-gray. Fringe of the same color as the wing ground color. Forewing with clearly visible middle dark belt, contain normally two big spots: discal and discoidal. Other spots on the forewing normally presented in the costal and basal parts. Hindwing from white or whitish to grey, external part of wing basically darker than internal, but not always. The variability is very wide and touch all wing pattern parts: spots, lines, ground color etc.

Male genitalia (pl. 3). Tegumen helmet-like. Uncus long (as long as tegumen), cylindrical, C-shaped, with sharp apex. Juxta shield-shaped with fork-shaped extensions dorsally. Valva long, narrowed in the middle part, with sharp apex (with some big cogs near the apex); in the narrow part there is rather short and thick harpa. Aedeagus short, about half of the valva , cylindrical, straight, relatively thick. When not everted, vesica with clearly visible cornutus inside; when everted, this cornutus occupies the middle position. Everted vesica (pl. 3, fig. 7) consists of two diverticula: apical diverticulum with spike-formish cornutus and caudal long cone-shaped diverticulum. The variability in male genitalia is present in the vesica cornutus length, valva shape and uncus length.

Female genitalia (pl. 4). Uniform in its structure, variability is only present in the bursa copulatrix size and shape and in the antrum sclerotization and size. Papillae anales relatively short, same length as its width. Apophyses anteriores and posteriores are thin, almost same in size, about 25–30% longer than papilla analis. Postvaginal plate wide, medium-sclerotized, horseshoe-shaped. Antrum not much sclerotized, with folded surface. Ductus bursae oval, not sclerotized.

Distribution. Widely distributed in Central Asia: Tian-Shan, Alai (including northern slope of Transalai Mts. and the Alai valley; also recorded from Kashgaria), Gissar and Darvaz; in West Pamir and Pakistan it is local. In Kazakhstan it was recorded from the mountain ridges Syrdaryinsky Karatau, Ketmen, Transili Alatau and Dzhungarian Alatau. A small and very interesting population was faced in the Boguty Mts. (Chingelsu valley) at the extreme altitudes (less than 1000 m). Can be distributed more widely, including some parts of Himalayas, Ladak and Karakorum ( Hacker 1990).

PL. 1. Bryophila plumbeola (Staudinger, 1881) and B. subliterata (Filipjev, 1931) , uppersides and labels. 1, 2: B. plumbeola miltophaea ( Hampson, 1908) , holotype. 3: B. plumbeola miltophaea ( Hampson, 1908) , 30.07.201 9, Suusamyrtoo Mts., 4 km N of Kyzyl-Oi, 1808 m, N41° 59.211’ E74° 09.396’ (Korb), SK0295 ( MT293783 View Materials ). 4, 20: B. plumbeola vilis ( Hampson, 1908) , 27- 28.07.2019, Talas Mts., Kara-Buura river, 31 km S of Kluchevka, 1707 m, N 42.337 976, E 71.607 27 (Korb), SK0293 ( MT293781 View Materials ); SK0292 ( MT293778 View Materials ). 5, 6: B. plumbeola miltophaea f. plumbina ( Draudt, 1931), type specimen. 7, 10, 11, 13, 14, 15, 18, 22: B. plumbeola miltophaea ( Hampson, 1908) , 29.07.201 9, Kyrgyzstan, Suusamyrtoo Mts., Kekemeren river valley, 12 km S of Kojomkul, 42.046 225 N,74.154575 E, 1874 m (Korb), SK0031; SK0041; SK0050; SK0055; SK0153; SK0053; SK0051; SK0052. 8: B. plumbeola miltophaea ( Hampson, 1908) , 25.07.201 6, Dzhumgaltoo Mts., 2 km N of Kojomkul, 2080 m, N42° 09.141’ E74° 04.131’ (Korb), MT293796 View Materials . 9: B. plumbeola miltophaea ( Hampson, 1908) , 20.07.201 6, Moldo-Too Mts., Koro-Goo Pass, 1997 m, N41° 31.303’ E74° 45.824’ (Korb), MT293794 View Materials . 12: B. plumbeola miltophaea ( Hampson, 1908) , 10- 16.07.2018, Moldo-Too Mts., Koro-Goo Pass, 1997 m, N41° 31.303’ E74° 45.824’ (Korb), SK0059. 16, 17: B. plumbeola miltophaea ( Hampson, 1908) , 26.07.201 6, Suusamyrtoo Mts., 4 km N of Kyzyl-Oi, 1808 m, N41° 59.211’ E74° 09.396’ (Korb), MT293789 View Materials , MT293790 View Materials . 19: B. subliterata (Filipjev, 1931) , 21.07.201 1, Tajikistan, 38 km SE of Khorog, 2982 m, N37° 12.102’ E71° 49.768’ (Korb), SK0243. 21: B. plumbeola hampsoni ( Draudt, 1931) , 15.07.201 5, Alai Mts., 9,6 km SW Kichi-Karakol, 2667 m, N39° 50.370’ E73° 19.593’ (Korb), SK0242. 23, 24: B. subliterata f. albiceps ( Draudt, 1931), type specimen.

PL. 2. Bryophila eucta ( Hampson, 1908) , B. moeonis (Lederer, 1865) and B. plumbeola (Staudinger, 1881) , uppersides and labels. 1, 2: B. eucta ( Hampson, 1908) , holotype. 3, 4: B. plumbeola miltophaea ( Hampson, 1908) , 26.07.201 6, Suusamyrtoo Mts., 4 km N of Kyzyl-Oi, 1808 m, N41° 59.211’ E74° 09.396’ (Korb), SK0252; SK0251. 5, 6: B. plumbeola hampsoni ( Draudt, 1931) , holotype. 7: B. moeonis (Lederer, 1865) , 11.09.193 2, Armenia, Dzhulfy Arakse (Ryabov). 8, 9: B. plumbeola hampsoni ( Draudt, 1931) , topotype. 10, 11, 12, 13, 14, 15, 16, 19, 20: B. plumbeola vilis ( Hampson, 1908) , 27- 28.07.2019, Talas Mts., Kara-Buura river, 31 km S of Kluchevka, 1707 m, N 42.337 976, E 71.607 27 (Korb), SK0048; SK0033; SK0294 ( MT293780 View Materials ); SK0306 ( MT293785 View Materials ); SK0034; SK0046; SK0035. 17, 18: B. plumbeola miltophaea ( Hampson, 1908) , 29.07.201 9, Dzhumgaltoo Mts., 2 km N of Kojomkul, 2080 m, N42° 09.141’ E74° 04.131’ (Korb), SK0133; SK0054. 21, 23: B. plumbeola vilis ( Hampson, 1908) , 13.07.201 5, Fergansky Mts., S shore of Toktogul reservoir, 1768 m, N41° 43.223’ E72° 57.165’ (Korb), SK0244; SK0246. 22: B. plumbeola plumbeola (Staudinger, 1881) , 7.07.201 5, Boguty Mts., Chingelsu valley, N43° 34.825’ E78° 39.847’, 851 m (Korb), SK0249. 24: B. plumbeola hampsoni ( Draudt, 1931) , 14.07.201 5, Alai Mts., valley between Tashkoro and Karabulak, 1805 m, N40° 14.119’ E73° 24.484’ (Korb), SK0247.

Ecology. The species inhabit a wide range of biotopes, from arid mountainous lowlands (Chingelsu valley) to alpine meadows with well-developed vegetation (West Karakol river valley in Inner Tian-Shan) (pl. 23, figs 1, 3, 4, 7). Its vertical zone is between 800 and 3200 m. One of the most frequent owlet moth species in its habitats (pl. 22, figs 1, 2, 7).

Remark. The problem with its ‘species richness’ (5 ‘species’ were treated from this one until current time) is explained by the very small type series. Actually not even one of the formerly described ‘species’ within B. plumbeola has a type series over 2 specimens. The species, as it is visible from our data, is highly variable externally (pl. 1, 2), the male genitalia of this species are variable too ( Table 3 View TABLE 3 ). The original descriptions based on 1– 2 specimens without checking the variability produced a number of these ‘fake’ species.

The female genitalia structure for all described forms is close (pl. 4), no good differences between the formerly supposed species are present. The male genitalia of all type specimens of all described taxa within this group were figured in the same paper ( Boursin 1954b). I reproduce these pictures here (pl. 5). Comparison of these figures is clear evidence of their conspecifics. First of all, the shape of valva is identical in all figured genitalia. The form and size of harpa is also same in all of them. Uncus, tegumen and other structures of these ‘species’ are also identical. Unfortunately the genitalia slides were made by Boursin without everting the vesica, but the apical spike is visible very well inside of every aedeagus. Its size is a subject of variability (pl. 3; Table 3 View TABLE 3 ). In some of the genitalia slides figured by Boursin the caudal zone of sclerotization within the aedeagus is well visible; in fact, and highly likely because of that, this is a result of too high contrast of the published pictures.

Note. The status of the taxon B. idonea (Christoph, 1893) (= B. taftana Brandt, 1939 ) requires further investigation. It was described from “Pul-i-Hatum, Tekke”, as usual by a small number of specimens; by its external features it is very close to B. plumbeola . The male genitalia of B. taftana ( Boursin 1954b: Abb. 12) are very close to B. plumbeola . It is very probable that this taxon is a synonym of B. plumbeola , but to be sure its DNA must be examined.

Bryophila plumbeola plumbeola Staudinger, 1881

(pl. 2, fig. 22; pl. 3, figs 16, 17; pl. 5, fig. 1)

Staudinger 1881: 410 ( Bryophila Plumbeola )

Type locality: “vom Saisan-Gebiet” (by original description).

Type material: holotype (by monotypy), ZMHU, not found. The figure of the holotype genitalia was published by Boursin (1954b: Abb. 7) and reproduced here (pl. 5, fig. 1).

Material examined. Kazakhstan. 23 ♂, 6 ♀, 7.07.201 5, Boguty Mts. , Chingelsu valley, N43° 34.825’ E78° 39.847’, 851 m (Korb) ( SK) GoogleMaps . 2 ♂, 20.06.201 7, Boro-Khoro Mts. , Usek river valley, N44° 28.082’ E79° 49.760’, 1260 m (Korb) ( SK) GoogleMaps . 1 ♂, 30.06.201 1, Boro-Khoro Mts. , 8 km N of Sarymbel, N44° 29.765’ E80° 03.848’, 1830 m (Korb) ( SK) GoogleMaps .

Distribution. Known from South-East Kazakhstan: Saisan lake environs, Saur Mts., Dzhungarian Alatau Mts., Boro-Khoro Mts., Boguty Mts., Sogety Mts.

Bryophila plumbeola miltophaea Hampson, 1908 , stat. n.

(pl. 1, figs 1–3, 5–18, 22; pl. 2, figs 3, 4, 17, 18; pl. 3, figs 1, 3, 4, 6, 7; pl. 4, figs 1, 4, 7–11; pl. 5, fig. 4)

Hampson 1908: 629–630; pl. 122, fig. 17 ( Bryophila miltophaea ).

Type locality: “W. Turkestan, Alexander Mts.” (by original description); “Gebirge nördlich vom Issykul” (by the lectotype designation).

Type material: “ type ♂, ♀ in Coll. Püngeler ” ( Hampson, 1908: 630), ZMHU, examined. Lectotype ♂ (pl. 1, figs. 1, 2), here designated, labelled: “Type | miltophaea Hmpsn. ♂ ” (pink paper, first line printed, second line handwritten); “GART | specimen ID: | 06471 | Exemplar + Etiketten | dokumentiert | specimen + label | data documented | 5.12.2003 ” (yellow paper, printed with last line partially handwritten); “ Asia centr. | Gebirge nördlich vom | Issykul | G. Rückbeil 1912” (white paper, first line printed, other lines handwritten); “PRÉPARATION | № MB. 219 | CH. BOURSIN” (white paper, first and last lines printed by red ink, middle line handwritten with printed ‘№’). Paralectotype ♀, ZMHU, same data .

= Bryophila plumbeola miltophaea f. plumbina Draudt, 1931.

Draudt 1931: 16, pl. 2, fig. d. ( Bryophila miltophaea f. plumbina).

Type locality: “West-Turkestan, Alexander-Gebirge” (by original description).

Type material: holotype (by monotypy) (pl. 1, figs 5, 6), ZMHU, examined. Specimen labelled: “Type. | Bryophila | miltophaea | plumbina | Drd.” (pink paper, handwritten); “GART | specimen ID: | 06507 | Exemplar + Etiketten | dokumentiert | specimen + label | data documented | 6.12.2003 ” (yellow paper, printed, last line partially handwritten); doublesided: “Asia centr. | Alexandergebirge | E. Juni Rückbeil” (white paper, first line printed, other lines handwritten) (one side) “5/05 v. Tancré” (handwritten) (other side).

Material examined. 1 ♂, 1 ♀, lectotype and paralectotype of miltophaea (ZMHU) ; 1 ♂, type specimen of plumbina ( ZMHU) . Kazakhstan. 16 ♂, 30 ♀, 10.07.201 5, Transili Alatau Mts. , near Almaty, N43° 06.108’ E76° 56.119’, 1583 m (Korb) ( SK) GoogleMaps ; 1 ♀, 30.06.201 5, Transili Alatau Mts., near Koram , N43° 29.358’ E78° 10.242’, 787 m (Korb) ( SK) GoogleMaps . Kyrgyzstan. 2 ♂, 16.07.201 4, Bishkek environs, Arashan , 1500 m, N 42° 45.274’ E 74° 38.001’ (Korb) ( SK) GoogleMaps ; 1 ♀, 10.08.201 6, Bishkek environs, Ala-Archa National Park , 2400 m, N 42° 32.316’ E 74° 28.884’ (Korb) ( SK) GoogleMaps ; 12 ♂, 7 ♀, 8.07.201 6, South shore of Issyk-Kul lake , 6,6 km E of Kara-Talaa, 1591 m, N42° 18.281’ E76° 28.904’ (Korb) ( SK) GoogleMaps ; 125 ♂, 260 ♀, 21.07.201 4, 25.07.201 6, 29.06.201 9, Dzhumgaltoo Mts. , 2 km N of Kojomkul, 2080 m, N42° 09.141’ E74° 04.131’ (Korb) ( SK) GoogleMaps ; 1 ♂, 3 ♀, 30.07.201 9, Suusamyrtoo Mts. , 4 km N of Kyzyl-Oi, 1808 m, N41° 59.211’ E74° 09.396’ (Korb) ( SK) GoogleMaps ; 20.07.201 6, 2- 8.07.2019, 16 ♂, 40 ♀, Moldo-Too Mts., Koro-Goo Pass , 1997 m, N41° 31.303’ E74° 45.824’ (Korb) ( SK) GoogleMaps ; 1 ♂, 21.07.201 6, Naryn river valley 6 km E of Kulanak, 1809 m, N41° 22.229’ E75° 34.436’ (Korb) ( SK) GoogleMaps ; 1 ♂, 2 ♀, 3- 8.07.2018, Katta-Kaindy Mts. , 8.5 km S of Englchek, 2509 m, N 41°57’518 E 79° 7’782 (Korb) ( SK) .

Distribution. North Tian-Shan (mountain ridges Ketmen, Kungey Ala-Too, Transili Alatau, Terskey Ala-Too (northern slope), Kirgizsky), Inner Tian-Shan, Central Tian-Shan.

Note. The status of the taxon plumbina is clearly infrasubspecific (described as “f. n.”). In fact, such “dark” specimens are rarely present in the populations of B. plumbeola within the North Tian-Shan, but over 90% of all captured specimens belong to the typical red form.

Remark. Recently from the Central Afgfanistan (type locality: “Afghan. Centr., 67ºL, 34º25’B, Band-i-Amir, 2800 m.”) described closely related species B. lugubris Gaal-Haszler, Lödl, Pekarsky, Ronkay G., Ronkay L. et Varga, 2012 ( Lödl et al. 2012: 123; fig. 7; pl. 75, figs. 46–48). The species distributed quite far from the studied area and due to this reason it is not included into current paper.

Bryophila plumbeola hampsoni Draudt, 1931 , stat. n.

(pl. 1, fig. 21; pl. 2, figs 5, 6, 8, 9, 24; pl. 3, fig. 8; pl. 5, fig. 2)

Draudt 1931: 17, pl. 2, fig. e. ( Bryophila hampsoni ).

Type locality: “Nord-Alai (Ispayran)” (by original description).

Type material: holotype (by monotypy) (pl. 2, figs 5, 6), ZMHU, examined. A specimen labelled: “Type | Bryophila | hampsoni | Pglr. i. l. Drd.” (pink paper, handwritten); “GART | specimen ID: | 06488 | Exemplar + Etiketten | dokumentiert | specimen + label | data documented | 5.12.2003 ” (yellow paper, printed, last line partially handwritten); “Ispajtan | Alai sept. | 3400m. August” (white paper, printed); two sided: “Asia centr.” (white paper, printed) (one side) “als Poliobrya | patula ♂ 2/1912 | v. Bang-Haas Püng.” (handwritten) (other side); “n. gen, n. sp., | Hampson, i.l. | 2.191 3 Püng.” (white paper, handwritten); “PRÉPARATION | № M.B. 218 | CH. BOURSIN” (white paper, first and last lines printed by red ink, middle line handwritten with printed ‘№’).

Material examined. Holotype ♂ ( ZMHU); 3 ♂, 2 ♀, 14.07.201 5, Alai Mts. , valley between Tashkoro and Karabulak, 1805 m, N40° 14.119’ E73° 24.484’ (Korb) ( SK); GoogleMaps 52 ♂, 12 ♀, 14.07.201 6, 16- 18.07.2019, Alai Mts. , 9,6 km SW Kichi-Karakol, 2667 m, N39° 50.370’ E73° 19.593’ (Korb) ( SK); GoogleMaps 12 ♂, 20 ♀, 21- 22.07.2019, Alai Mts. , 6,25 km NNE Kyzyl-Eshme , 2961 m, 39.620 689 N,72.286766 E (Korb) ( SK); 4 ♂, 4 ♀, 24.07.201 9, Kyrgyzstan, Fergansky Mts., Kara-Suu river coast, 1232 m, N 41.685 956 E 72.974 411 (Korb) ( SK). GoogleMaps

Distribution. Alai and Transalai Mts., southern and central parts of Fergansky Mts. Southern limit of its distribution is the northern slope of Transalai Mts.

PL. 3. Bryophila plumbeola (Staudinger, 1881) , B. subliterata (Filipjev, 1931) , male genitalia. 1, 3, 4, 6, 7: B. plumbeola miltophaea ( Hampson, 1908) , 29.07.201 9, Kyrgyzstan, Suusamyrtoo Mts., Kekemeren river valley, 12 km S of Kojomkul, 42.046 225 N,74.154575 E, 1874 m (Korb). 2, 5, 13, 15: B. plumbeola vilis ( Hampson, 1908) , 27- 28.07.2019, Talas Mts., Kara- Buura river, 31 km S of Kluchevka, 1707 m, N 42.337 976, E 71.607 27 (Korb). 8: B. plumbeola hampsoni ( Draudt, 1931) , 15.07.201 5, Alai Mts., 9,6 km SW Kichi-Karakol, 2667 m, N39° 50.370’ E73° 19.593’ (Korb). 9: B. subliterata (Filipjev, 1931) , 21.07.201 1, Tajikistan, 38 km SE of Khorog, 2982 m, N37° 12.102’ E71° 49.768’ (Korb). 10: B. plumbeola vilis ( Hampson, 1908) , 13.07.201 5, Fergansky Mts., S shore of Toktogul reservoir, 1768 m, N41° 43.223’ E72° 57.165’ (Korb). 11, 12: 14.07.201 5, Alai Mts., valley between Tashkoro and Karabulak, 1805 m, N40° 14.119’ E73° 24.484’ (Korb). 14: 30.07.201 9, Suusamyrtoo Mts., 4 km N of Kyzyl-Oi, 1808 m, N41° 59.211’ E74° 09.396’ (Korb). 16, 17: B. plumbeola plumbeola (Staudinger, 1881) , 7.07.201 5, Boguty Mts., Chingelsu valley, N43° 34.825’ E78° 39.847’, 851 m (Korb). Genitalia, frontal view, aedeagus removed: 1, 2, 11, 16. Aedeagus, vesica everted: 3–10, 12–15, 17. Samples and slides: 1, 3: SK0030 ; 4: SK0032 ; 5: SK0049 ( MT 293780 View Materials ) , 6: SK0051 ; 7: SK0055 ; 8: SK0242 ; 9: SK0243 ; 10: SK0246 , 11 , 12 : SK0247 ; 13: SK0293 ( MT 293781 View Materials ) ; 14: SK0295 ( MT 293783 View Materials ) ; 15: SK0302 ; 16, 17: SK0423 .

PL. 4. Bryophila plumbeola (Staudinger, 1881) , female genitalia. 1, 4, 7, 8, 9, 10: B. plumbeola miltophaea ( Hampson, 1908) , 29.07.201 9, Kyrgyzstan, Suusamyrtoo Mts., Kekemeren river valley, 12 km S of Kojomkul, 42.046 225 N,74.154575 E, 1874 m (Korb), SK0031 ; SK0041 ; SK0050 ; SK0052 ; SK0053 ; SK0054 . 2, 3, 5, 6, 12, 13, 14, 15: B. plumbeola vilis ( Hampson, 1908) , 27- 28.07.2019, Talas Mts. , Kara-Buura river, 31 km S of Kluchevka, 1707 m, N 42.337 976, E 71.607 27 (Korb) GoogleMaps , SK0033 ; SK0035 ; SK0046 ; SK0048 ; SK0292 ( MT 293778 View Materials ) ; SK0294 ( MT 293780 View Materials ) ; SK0303 ; SK0306 ( MT 293785 View Materials ) . 11: B. plumbeola miltophaea ( Hampson, 1908) , 10- 16.07.2018, Moldo-Too Mts. , Koro-Goo Pass, 1997 m, N41° 31.303’ E74° 45.824’ (Korb) GoogleMaps , SK0059 . 15: 27- 28.07.2019, Talas Mts. , Kara-Buura river, 31 km S of Kluchevka, 1707 m, N 42.337 976, E 71.607 27 (Korb) GoogleMaps , SK0306 ( MT 293785 View Materials ) .

Bryophila plumbeola vilis Hampson, 1908 , stat. n.

(pl. 1, figs 4, 20; pl. 2, figs 10–16, 19–21, 23; pl. 3, figs 2, 5, 10, 13, 15; pl. 4, figs 14, 15; pl. 5, fig. 6)

Hampson 1908: 632; pl. 122, fig. 22. ( Bryophila vilis ).

Type locality: “W. Turkestan, Merv” (by original description).

Type material: “type ♂, ♀ in Coll. Püngeler”, not found. The picture of the syntype was published in the origi- nal description; the figure of its genitalia was published by Boursin (1954b: Abb. 13).

Material examined. Kazakhstan. 1 ♂, 17.07.201 7, Syrdaryinsky Karatau Mts. , 6 km SE of Turlan, 645 m (Komarov) ( SK) . Kyrgyzstan. 16 ♂, 2 ♀, 26.07.201 9, Talassky Mts. , 5,44 km NWW of Cheleke vill., 1926 m, N 42.413 146, E 72.860 289 (Korb) ( SK) GoogleMaps ; 62 ♂, 49 ♀, 27- 28.07.2019, Talas Mts. , Kara-Buura river, 31 km S of Kluchevka, 1707 m, N 42.337 976, E 71.607 27 (Korb) ( SK) GoogleMaps .

Distribution. West Tian-Shan (including Syrdaryinsky Karatau Mts.), Gissar, Darvaz.

Bryophila plumbeola puengeleri Draudt, 1931 , stat. n.

Draudt 1931: 16; pl. 2, fig. d. ( Bryophila püngeleri ).

Type locality: “Yarkend und Ost-Turkestan von Chamil Hami” (by original description).

Type material: neotype, ZMHU, not found. The picture of the syntype was published in the original description; the figure of the neotype genitalia was published by Boursin (1954b: Abb. 11). The neotype was designated by Boursin (1954b: 88).

Distribution. East (Chinese) Tian-Shan.

Bryophila subliterata Filipjev, 1931

(pl. 1, fig. 19; pl. 6; pl. 7, figs 10, 13–20)

Filipjev 1931: 156–157; Fig. 4; Taf. 4, Fig. 4 ( Bryophila subliterata ).

Type locality: “Chorog” (by original description).

Type material: syntypes (1 ♂, 1 ♀), ZISP, not found, probably lost; I can also suggest that types of this species may be in someone’s loan. Due to the reason that the male syntype of this species is well documented in its original description (both specimen habitus (photograph) and male genitalia (b/w drawing), I designate here using the Art. 74.4 of the Code the lectotype of this species, a male specimen figured in the original description (Filipjev 1931: Taf. 4, Fig. 4).

= Bryophila plumbeola View in CoL f. albiceps Draudt 1931: 17, pl. 2c. (B.[ryophila] albiceps).

Type locality: “von Garm, Gebirge Peter der Grosse” (by original description).

Type material: holotype (by monotypy), ZMHU, examined. The type specimen (pl. 1, figs 23, 24) labelled: “Type. | Bryophila | albiceps | Drd.” (pink paper, handwritten); “ex coll. 1/1 | BANG-HAAS” (white paper, printed, numbers handwritten); “GART | specimen ID: | 06839 | Exemplar + Etiketten | dokumentiert | specimen + label | data documented | 28.VII. 2004 ” (yellow paper, printed, last line partially handwritten); “Garm | Gbg. Peter d. Gr. | Juni” (white paper, printed); “ Cryphia | subliterata | Filipjev | (=albiceps Drdt.) | Boursin det ♂ ” (white paper, handwritten, last line printed); “PRÉPARATION | № M.B. 216 | CH. BOURSIN” (white paper, first and last lines printed by red ink, middle line handwritten with printed ‘№’).

Redescription (pl. 1, fig. 19; pl. 7, figs 10, 13–20). Forewing length 11–15 mm. Wings ground color vary from almost brown to very dark red-gray. Fringes of the same color as the wings ground color. Forewing with clearly visible slightly darker than ground color middle belt, discal and discoidal spots invisible or poorly visible, kidneyshaped. Hindwing is from white to whitish, external part of the wing basically darker than internal, but not always; discal spot can be poorly visible or invisible, but mostly visible as a bit darker than groud color small spot with unclear border. The variability is very wide and touch all wing pattern parts: spots, lines, ground color etc.

Male genitalia (pl. 6, figs 5–7). Tegumen helmet-like. Uncus long (as long as tegumen), cylindrical, with sharp apex. Juxta fork-shaped with wide lobes. Valva long, a slightly tapering medially middle part, with sharp and curved apex; in the narrow part there is a long and thin C-shaped harpa. Aedeagus short, about half of the valva , cylindrical, straight, relatively thick. When not everted, vesica with clearly visible cornutus inside; when everted, this cornutus occupies the middle position.

Female genitalia (pl. 6, figs 1–4). Uniform in its structure, variability is only present in the bursa copulatrix size and shape and in the antrum sclerotization and size. Papillae anales relatively short, same length as its width. Apophyses anteriores and posteriores are thin, almost same in size, about 25–30% longer than papilla analis. Postvaginal plate almost not sclerotized, small, oval. Antrum weakly sclerotized, with folded surface. Ductus bursae oval or close shape, not sclerotized.

Material examined. Tajikistan. Holotype ♂ of albiceps ( ZMHU); 6 ♂, 2 ♀, 20.07.201 1, Tajikistan , 7,7 km N of Kulyab, 669 m, N37° 59.017’ E69° 48.427’ (Korb) ( SK); GoogleMaps 12 ♂, 16 ♀, 21.07.201 1, Tajikistan , 38 km SE of Khorog, 2982 m, N37° 12.102’ E71° 49.768’ (Korb) ( SK); GoogleMaps 2 ♂, 20.07.201 1, Tajikistan , Khorog environs, Khorog botanical garden, 2281 m, N37° 28.444’ E71° 36.100’ (Korb) ( SK). GoogleMaps

Distribution. West Pamir, Darvaz; recorded from the mountain ranges Darvazsky, Peter the Great, Vanchsky, Yazgulemsky, Rushansky and Shugnansky; adjanced areas of Afghanistan ( Lödl et al. 2012).

Ecology. The species inhabit dry mountainous areas like dry stony slopes, mountainous steppes etc., at the elevations between 600 and 3000 m. (pl. 22, fig. 5).

PL. 5. Bryophila , male genitalia (by Boursin 1954b; 1970): 1. B. plumbeola plumbeola (Staudinger, 1881) , holotype. 2. B. plumbeola hampsoni ( Draudt, 1931) , holotype. 3. B. subliterata f. albiceps ( Draudt, 1931), type specimen. 4. B. plumbeola miltophaea ( Hampson, 1908) , holotype. 5. B. plumbeola puengeleri ( Hampson, 1908) , neotype. 6. B. plumbeola vilis ( Hampson, 1908) , holotype. 7. B. acharista Boursin, 1970 , paratype. 8. B. icterica Boursin, 1960 , paratype. 9. B. eucta ( Hampson, 1908) , holotype.

Remark. The type material of this taxon was not found in its depository (possibly lost), but the illustration of the type specimen and its genitalia published in the original description does not make any confusion with its identification. Its DNA sequenced from the material collected 40 km away from its type locality.

Bryophila acharista ( Boursin, 1970)

(pl. 8, fig. 24; pl. 5, fig. 7)

Boursin, 1970: 53–55; figs 67–69 ( Cryphia (Scythobrya) acharista ).

Type locality: “NW-Karakorum, Hunza-Nagar, Bar (2500 m), 36/23 lat. n., 74/17 long. est.” (by original description).

Type material: holotype ♂, paratypes 11 ♂, 12 ♀, all ZSM, not examined. Very well illustrated in the original description.

Redescription (pl. 8, fig. 24). Forewing length 10–15 mm. Wings upperside ground color vary from almost brown to very dark red-gray. Fringes of the same color as the wings ground color. Forewing with clearly visible middle slightly darker than ground color belt, discal and discoidal spots invisible or poorly visible, kidney-shaped. Hindwing is from white to whitish, external part of the wing basically darker than internal, but not always; discal spot can be poorly visible or invisible, but mostly visible as a bit darker than groud color small spot with unclear border.

Male genitalia (pl. 5, fig. 7). Tegumen triangle, uncus relatively short, about 50–60% of the length of the tegumen, cylindrical, straight, with pointed apex. Valva long, almost rectangular, with small narrowing in its central part. On the narrowing area the long and almost straight harpa is present. The valva’s apex with 2–3 long cogs and several (3–6) small ones.

Female genitalia. Not studied.

Material examined. 1 ♂, 4.08.195 8, Tajikistan, Mts. Darwaz , cliv. merid., fl. Wischarwi 2200 m (Bundel) ; 2 ♂, 15.07.201 1, Tajikistan, Zangerya kishlak environs, 1130 m, N38° 18.485’ E70° 36.216’ (Korb) ( SK) GoogleMaps .

Distribution. Known from Pakistan (North-West Karakorum, Gilgit, Baltistan), Afghanistan (Vakhan territory) and South-West Tajikistan (Darvazsky Mts.).

Ecology. Same as in the previous species (pl. 22, fig. 5).

? Bryophila icterica ( Boursin, 1960)

(pl. 5, fig. 8)

Boursin, 1960: 171 – 172 ( Cryphia (Scythobria) icterica ).

Type locality: “Achmed Dewane, Vallée de la Bashgul (Nuristan), 2700 m ” (after original description) .

Type material: holotype ♂, paratypes amount is not stated (“…plusieurs ♂♂ et ♀♀ …” (loc. cit.), in the collec- tions of Klapperich and Boursin; not examined. The type specimen and its genitalia are very well figured by Boursin (1970: figs 70, 72).

Note. This species I include into the studied fauna preliminarily, because it was described from the neighboring areas of Afghanistan and its occurrence in Tajikistan (vicinities of Khorog) is possible.

Bryophila eucta Hampson, 1908

(pl. 2, figs 1, 2; pl. 5, fig. 9)

Hampson 1908: 631; pl. 122, fig. 20 ( Bryophila eucta ).

Type locality: “ W. Turkestan, Askabad ” (by original description) .

Type material: holotype (by monotypy), ZMHU, examined (pl. 2, figs 1, 2). A specimen labelled “Type | eucta Hmpsn ♂ ” (pink paper, first line printed, second line handwritten); “GART | specimen ID: | 06506 | Exemplar + Etiketten | dokumentiert | specimen + label | data documented | 6.12.2003 ” (yellow paper, printed, last line partially handwritten); “Préparation | no M.B. 83 | Ch. Boursin ” (white paper, printed, second line partially handwritten); double-sided: “Asia centr. | Aschabad ” (white paper) (first side, first line printed, second line handwritten), “5/05 v. R. Tancré ” (second side, handwritten) .

Remark. This species was recorded from Kyrgyzstan (Nekrasov 1988; Milko 1996; Lehmann & Bergmann 2005; Korb et al. 2016), most likely, by misidentification. It is very close by its wing pattern to B. plumbeola hampsoni (pl. 2, figs 1, 2, 5, 6) but differs very well by its male genitalia (see Boursin 1954b: Abb. 14; pl. 3), so if it was not checked by genitalia, the erroneous indication is quite possible. Not even single specimen of this species was confirmed by genitalia investigation from Kyrgyzstan.

Redescription (pl. 2, figs 1, 2). Forewing length 12–16 mm. Wings upperside ground color vary from almost white to yellow. Fringes of the same color as the wings ground color. Forewing with clearly visible middle dark belt, discal and discoidal spots poorly visible, kidney-shaped. Basal area of the forewing is darkened. Hindwing is from white to yellowish; discal spot is well visible, rectangular or close shape.

Male genitalia (pl. 5, fig. 9). Tegumen triangle, uncus relatively short, about half of the length of the tegumen, cylindrical, straight, with pointed apex. Valva long, pear-shaped, with thickening in its basal part and rounded apex. On the end of the thickening area the long and almost straight harpa is present. Aedeagus thick, short (about 3 times shorter than valva ), vesica with no cornutus.

Female genitalia. Not studied.

Subspecies and variation. As usual for this group in Central Asia, this taxon was described by only one specimen. The taxon hannemanni was described also by the very limited amount of specimens (1 male, 2 females). Due to the studied variability within this group and according the published images of the male genitalia ( eucta: Boursin 1954b : Taf. 8, Abb. 14; hannemanni: Boursin 1961 : Taf. 10, Abb. 7) which in fact are identical and all differences come from the fact that genitalia are reproduced under different angles, I conclude that the taxon hannemanni is a subspecies of eucta and give this taxon a new status.

Bryophila eucta eucta ( Hampson, 1908)

Material examined. Tajikistan. 1 ♂, 11.08.195 5, Dist. Wantsch, Poi-Mazar , 2400 m (Bundel) ( ZISP). Turkmenistan. Holotype ( ZMHU). 2 ♂, 12.06.197 2, Askhabad vicinity, Firuza valley, 800 m (local collector) ( SK).

Distribution. Kopet-Dagh Mts., West Pamir (Vanchsky Mts.); most likely, widely distributed in South-West Tajikistan and North-West Afghanistan.

Bryophila eucta hannemanni ( Boursin, 1961) , stat. n.

Boursin 1961: 142–143; Taf. 10, Fig. 2, 3 ( Cryphia (Bryoleuca) hannemanni ).

Type locality: “Margelan (Russisch Turkestan)” (by original description).

Type material: holotype ♂, paratypes 2 ♀, ZMHU , not found. Figured in the original description.

Distribution. Known from the deserts and semideserts of Fergana valley; all other records from mountainous Central Asia belong to B. plumbeola . It is possible to found this taxon in the foothills of West Tian-Shan and Gissar.

Bryophila sordida Staudinger, 1900

(pl. 8, figs 1–23; 9; 10)

Staudinger 1900: 358 ( Bryophila Moeonis Ld. var. (ab.) Sordida Stgr.).

Type locality: “Aus verschiedenen Theilen Central-Asiens, wie dem Ferghana-, Saratschan- und Karategin-Gebiet, sowie aus Transcaspien… von Askhabad” (by original description).

PL. 6. Bryophila subliterata (Filipjev, 1931) , genitalia. 1–4: female; 5–7: male. 1, 2, 4: 15.07.201 1, Tajikistan, Zangerya kishlak environs, 1130 m, N38° 18.485’ E70° 36.216’ (Korb), SK0054 ; SK0245 ; SK0258 . 3: 22.07.201 1, Tajikistan, 38 km SE of Khorog , 2982 m, N37° 12.102’ E71° 49.768’ (Korb) GoogleMaps , SK0248 . 5, 6: 15.07.201 1, Tajikistan, Zangerya kishlak environs, 1130 m, N38° 18.485’ E70° 36.216’ (Korb) GoogleMaps , SK0257 (frontal view (5) and aedeagus, vesica everted (6). 7: Holotype, by Filipjev 1931: Taf. 4, Fig. 4.

PL. 7. Bryophila , uppersides. 1: B. sordida (Staudinger, 1900) , Tajikistan, Shakhdarinsky Mts., Badjond-Dara river, 3500 m (Bundel), ZISP. 2: B. sordida (Staudinger, 1900) , 16.07.201 1, Tajikistan, near kishlak Vodzh, 2672 m, N37° 41.887’ E71° 55.821’, SK 0253. 3, 4, 5, 6, 7, 8: B. sordida (Staudinger, 1900) , 15.07.201 1, Tajikistan, Zangerya kishlak environs, 1130 m, N38° 18.485’ E70° 36.216’ (Korb), SK 0265; SK 0259; SK 0260; SK 0266; SK 0270; SK 0271. 9: B. sordida (Staudinger, 1900) , 17.07.201 7, Kazakhstan, Syrdaryinsky Karatau Mts., 6 km SE of Turlan, 645 m (Komarov), SK 0320. 10: B. subliterata (Filipjev, 1931) , 15.07.201 1, Tajikistan, Zangerya kishlak environs, 1130 m, N38° 18.485’ E70° 36.216’ (Korb), SK 0339. 11: B. sordida (Staudinger, 1900) , 13.07.201 6, Kyrgyzstan, Fergansky Mts., 11 km SE of Tortkol, 1218 m, N41° 41.161’ E72° 58.459’ (Korb), SK 0382. 12: B. sordida (Staudinger, 1900) , 17.07.201 7, Kazakhstan, Syrdaryinsky Karatau Mts., 6 km SE of Turlan, 645 m (Komarov), SK 0352. 13, 14, 15, 18, 19: B. subliterata (Filipjev, 1931) , 15.07.201 1, Tajikistan, Zangerya kishlak environs, 1130 m, N38° 18.485’ E70° 36.216’ (Korb), SK 0256; SK 0054; SK 0245; SK 0257; SK 0258. 16, 17: B. subliterata (Filipjev, 1931) , 22.07.201 1, Tajikistan, 38 km SE of Khorog, 2982 m, N37° 12.102’ E71° 49.768’ (Korb), SK 0248; SK 0250. 20: B. subliterata (Filipjev, 1931) , holotype reproduction from the original description (Filipjev 1931: Fig. 4). 21–23: C. istaravshana Pekarsky, 2020 , paratypes, 15.07.201 1, Tajikistan, Zangerya kishlak environs, 1130 m, N38° 18.485’ E70° 36.216’ (Korb), SK 0323, SK 0324, SK 0327. 24: B. istaravshana Pekarsky, 2020 , paratype, 13.07.201 5, Fergansky Mts., S shore of Toktogul reservoir, 1768 m, N41° 43.223’ E72° 57.165’ (Korb), SK 0322. Scale bar: 1 cm.

PL. 8. Bryophila sordida (Staudinger, 1900) (1–23) and B. acharista Boursin, 1970 (24), uppersides. 1: Syntype. 2, 20: 15.07.201 1, 15.07.201 1, Tajikistan, Zangerya kishlak environs, 1130 m, N38° 18.485’ E70° 36.216’ (Korb), SK0255 ; SK0261 . 3: 24.07.201 9, Kyrgyzstan, Fergansky Mts. , Kara-Suu river coast, 1232 m, N 41.685 956 E 72.974 411 (Korb) GoogleMaps , SK0151 . 4 – 9: 13.07.201 5, Fergansky Mts. , S shore of Toktogul reservoir, 1768 m, N41° 43.223’ E72° 57.165’ (Korb) GoogleMaps , SK0389 ; SK0390 ; SK0388 ; SK0387 ; SK0386 . 10–17, 19: 25.07.201 9, Kyrgyzstan, Fergansky Mts. , Kara-Suu river coast, 1232 m, N 41.685 956 E 72.974 411 (Korb) GoogleMaps , SK0150 ; SK0159 ; SK0170 ; SK0207 ; SK0232 ; SK0238 ; SK0239 ; SK0304 ( MT 293786 View Materials ) . 18: 17.07.201 7, Kazakhstan, Syrdaryinsky Karatau Mts. , 6 km SE of Turlan, 645 m (Komarov) , SK0319 . 21: 20.06.197 4, Turkmenistan, Central Kopet-Dagh , near Askhabad, Ay-Dere valley, 900 m (local collector) , SK0262 . 22: 16.07.198 5, Uzbekistan, Zeravshansky Mts. , Fanskie Gory , alpine camp Artuch ( Nekrasov ). 23: 7.07.197 6, Tajikistan, Gissarsky Mts. , alpine camp Varzob , 2500 m (Prasolov); 24: 6.07.198 0, Gissarsky Mts., Kondara valley (Pliustsh). Photos: 1–23 by the author, 24 by A.Y. Matov. Scale bar: 1 cm .

Type material. A number of specimens (no exact amount was stated in the original description), syntypes, ZMHU, examined (pl. 8, fig. 1): 2 ♂, 3 ♀, labelled “Askhabad”, “Karateguin”, “Serawschan”, “Ferghana”; all of them with label “Origin.” (violet paper, printed) .

Remark. Some authors consider this taxon as a synonym or subspecies of B. moeonis or B. praecana (Christoph, 1893) ( Boursin 1954a; 1961; Hampson 1908). This opinion based on the studying of very limited material – only few type specimens. By examination of a large series I can conclude that B. sordida definitely is a good species; the question about relations between B. moeonis and B. praecana remain opened; both taxa distributed far away from the mountainous Central Asia and are not a topic of the current paper. Actually the question about B. moeonis and its allies requires further investigation with wide DNA sequencing.

Redescription (pl. 8). Forewing length 10–14 mm. Wings from grey to light-brown, forewing is always darker than hindwing. The forewing pattern is: a bit darker than ground color middle belt, limited from both sides by thin light lines (basal and postmedial); discoidal spot is always present, in dark aberrations limited by thin light line, in light aberrations it is darker than ground color; discal spot can be visible, but mostly invisible; if visible, it is always unclear and incomplete; in all color forms the submarginal light line of serrated shape is present; small light and dark disordered spots and dots can be present on the whole forewing surface. Hindwing one-colored, lighter than forewing, with dot-shaped darker discal spot. Normally the marginal area of the hindwing is darker than its medium and basal areas. Fringes of the same color as wings. Wing variability is very wide and can be represented both in the coloration and in the pattern. The coloration of the wings varies from dark-grey (almost black) trough olive to dark-brown. The wing pattern can vary in the following features: pattern intensity; presence or absence of brown (to yellowish) color in forewing unclear spots; configuration and order of the wing unclear spots; discal and discoidal spots shape and intensity.

Male genitalia (pl. 9). Tegumen triangle, its apex is rounded. Uncus long (20% shorter than tegumen), cylindrical, with rounded apex and small coracoid process on it. Valva oblong-tirangular, with curved sharp apex; no harpa is present or harpa is small and thin. Juxta rhomb-shaped. Aedeagus short and thick, cylindrical, straight. Vesica everted bag-shaped, dermatoid, with small sclerotized cornutus (sometimes it can look like tiny spike).

Female genitalia (pl. 10). Papillae anales relatively short, shorter than its width. Apophyses anteriores and posteriores are thin, almost same length. Postvaginal plate poorly sclerotized, small, oval or rounded. Antrum triangular, with sclerotization zone (formed by small sclerotized dots) on the antrum basal part (this part is wider). Ductus bursae long-oval, not sclerotized.

Subspecies and variability. Highly variable species, vary in almost all external features: wing pattern, wing coloration, wing shape etc. The male genitalia are also variable ( Table 3 View TABLE 3 ) as far as the female genitalia (bursa shape and size, antrum sclerotization etc.). Due to this reason I do not see any point to separate any subspecies within its area.

Material examined. Kazakhstan. 1 ♂, 10.07.201 5, Transili Alatau Mts. , near Almaty, N43° 06.108’ E76° 56.119’, 1583 m (Korb) ( SK) GoogleMaps . Kyrgyzstan. 11 ♂, 6 ♀, 26.07.201 9, Talassky Mts. , 5,44 km NWW of Cheleke vill., 1926 m, N 42.413 146, E 72.860 289 (Korb) ( SK) GoogleMaps ; 6 ♂, 21 ♀, 27- 28.07.2019, Talas Mts., Kara-Buura river , 31 km S of Kluchevka, 1707 m, N 42.337 976, E 71.607 27 (Korb) ( SK) GoogleMaps ; 2 ♂, 2 ♀, 13.07.201 5, Fergansky Mts. , S shore of Toktogul reservoir, 1768 m, N41° 43.223’ E72° 57.165’ (Korb) ( SK) GoogleMaps ; 1 ♂, 10.07.201 4, Moldo-Too Mts. , Ak-Kyia environs, 1667 m, N41° 26.906’ E74° 50.822’ (Korb) ( SK) GoogleMaps ; 3 ♀, 21.07.201 6, Naryn river valley 6 km E of Kulanak, 1809 m, N41° 22.229’ E75° 34.436’ (Korb) ( SK) GoogleMaps ; 15 ♂, 15 ♀, 13.07.201 6, Fergansky Mts. , 11 km SE of Tortkol, 1218 m, N41° 41.161’ E72° 58.459’ (Korb) ( SK) GoogleMaps ; 2 ♂, 17.07.201 6, Fergansky Mts. near Urum-Bash, 1655 m, N41° 11.121’ E73° 22.812’ (Korb) ( SK) GoogleMaps ; 6 ♂, 1 ♀, 15.07.201 5, Alai Mts. , 9,6 km SW Kichi-Karakol, 2667 m, N39° 50.370’ E73° 19.593’ (Korb) ( SK) GoogleMaps ; 1 ♂, 21- 22.07.2019, Alai Mts. , 6,25 km NNE Kyzyl-Eshme, 2961 m, 39.620 689 N,72.286766 E (Korb) ( SK) . Tajikistan. 1 ♀, 24.07.201 1, Tajikistan, Darvazsky Mts. , Khaburobot Pass, 3297 m, N38° 37.343’ E70° 43.112’ (Korb) ( SK) GoogleMaps ; 12 ♂, 16 ♀, 2.07.201 1, Tajikistan, near kishlak Obigarm, 1408 m, N38° 43.257’ E69° 41.013’ (Korb) ( SK) GoogleMaps ; 10 ♂, 10 ♀, 16.07.201 1, Tajikistan, near kishlak Vodzh, 2672 m, N37° 41.887’ E71° 55.821’ (Korb) ( SK) GoogleMaps ; 13 ♂, 4 ♀, 21- 22.07.2011, Tajikistan, 38 km SE of Khorog , 2982 m, N37° 12.102’ E71° 49.768’ (Korb) ( SK) GoogleMaps ; 22 ♂, 12 ♀, 15.07.201 1, Tajikistan, Zangerya kishlak environs, 1130 m, N38° 18.485’ E70° 36.216’ (Korb) ( SK) GoogleMaps .

Distribution. Widely distributed in Central Asia and represented in all mountain areas from North Tian-Shan to Pamir.

Ecology. Dry stony slopes, mountainous steppes are the preferred habitats of this species. Vertical zone: 1200– 3200 m (pl. 22, figs 1, 3, 4, 7).

PL. 9. Bryophila sordida (Staudinger, 1900) , male genitalia. 1, 2, 3, 4, 5, 6, 9: 13.07.201 5, Fergansky Mts., S shore of Toktogul reservoir, 1768 m, N41° 43.223’ E72° 57.165’ (Korb). 7, 8, 10: 25.07.201 9, Kyrgyzstan, Fergansky Mts., Kara-Suu river coast, 1232 m, N 41.685 956 E 72.974 411 (Korb), SK0304 ( MT 293786 View Materials ) . 1, 2, 5, 8: frontal view; 3, 4, 6, 7, 9, 10: aedeagus, vesica everted. Slides and samples: 1, 3: SK0389 ; 2, 4: SK0381 ; 5, 6: SK0382 ; 7: SK0304 ( MT 293786 View Materials ) ; 8, 10: SK0150 ; 9: SK0390 .

PL. 10. Bryophila sordida (Staudinger, 1900) , female genitalia. 1, 4, 5, 6: 13.07.201 5, Fergansky Mts., S shore of Toktogul reservoir, 1768 m, N41° 43.223’ E72° 57.165’ (Korb), SK0318 ; SK0386 ; SK0387 ; SK0388 . 2: 24.07.201 9, Kyrgyzstan, Fergansky Mts. , Kara-Suu river coast, 1232 m, N 41.685 956 E 72.974 411 (Korb) GoogleMaps , SK0238 . 3, 9, 10: 15.07.201 1, Tajikistan, Zangerya kishlak environs, 1130 m, N38° 18.485’ E70° 36.216’ (Korb) GoogleMaps , SK0255 ; SK0260 ; SK0270 . 11, 12: 17.07.201 7, Kazakhstan, Syrdaryinsky Karatau Mts. , 6 km SE of Turlan, 645 m (Komarov) , SK0352 ; SK0320 .

PL. 11. Bryophila rueckbeili Boursin, 1953 , uppersides. 1: 27- 28.07.2019, Talas Mts., Kara-Buura river, 31 km S of Kluchevka, 1707 m, N 42.337 976, E 71.607 27 (Korb). 2, 3: Paratype. 4: 20.07.201 6, Moldo-Too Mts.   GoogleMaps , Koro-Goo Pass   GoogleMaps , 1997 m, N41° 31.303’ E74° 45.824’ (Korb), MT293795 View Materials . 5, 6, 8: 29.07.201 9, Kyrgyzstan, Suusamyrtoo Mts.   GoogleMaps , Kekemeren river   GoogleMaps valley, 12 km S of Kojomkul, 42.046 225 N,74.154575 E, 1874 m (Korb), SK0025 ; SK0026 GoogleMaps ; SK0036 . 7, 9, 10: 27- 28.07.2019, Talas Mts., Kara-Buura river , 31 km S of Kluchevka, 1707 m, N 42.337 976, E 71.607 27 (Korb), SK0029 GoogleMaps ; SK0038 GoogleMaps ; SK0136 . 11, 12, 23: 7.07.201 5, Boguty Mts., Chingelsu valley , N43° 34.825’ E78° 39.847’, 851 m (Korb), SK0360 GoogleMaps ; SK0359 GoogleMaps ; SK0340 . 13, 20, 22: 15.07.201 1, Tajikistan, Zangerya kishlak environs, 1130 m, N38° 18.485’ E70° 36.216’ (Korb), SK0334 GoogleMaps ; SK0326 GoogleMaps ; SK0355 . 14: 24.07.201 9, Kyrgyzstan, Fergansky Mts., Kara-Suu river coast, 1232 m, N 41.685 956 E 72.974 411 (Korb), SK0205 GoogleMaps . 15: 10.07.201 4, Moldo-Too Mts., Koro-Goo Pass , 1997 m, N41° 31.303’ E74° 45.824’ (Korb), SK0335 GoogleMaps . 16: 21.07.201 4, Kyrgyzstan, Bishkek environs, Sarban, 1000 m ( Korb ), SK0358 . 17: 8.08.201 4, Kyrgyzstan, Bishkek environs, Kok-Jar, 800 m ( Korb ), SK0357 . 18: 10.07.201 5, Transili Alatau Mts., near Almaty , N43° 06.108’ E76° 56.119’, 1583 m (Korb), SK0333 GoogleMaps . 19: 13.07.201 5, Fergansky Mts., S shore of Toktogul reservoir, 1768 m, N41° 43.223’ E72° 57.165’ (Korb), SK0330 GoogleMaps . 21: 30.06.201 5, Transili Alatau Mts., near Koram , N43° 29.358’ E78° 10.242’, 787 m (Korb), SK0354 GoogleMaps . 24: 14.07.201 5, Alai Mts. , valley between Tashkoro and Karabulak, 1805 m, N40° 14.119’ E73° 24.484’ (Korb), SK0332 GoogleMaps . Scale bar: 1 cm.

Bryophila rueckbeili ( Boursin, 1953)

(pl. 11, 12, 13)

Boursin 1953: 248–249; Taf. 6, Fig. 1, 2 ( Cryphia rückbeili ).

Type locality: “Umgebung Dscharkent (bei Kuldscha, Ili-Gebiet, Russisch Turkestan)” (by original description).

Type material: Holotype: 1 ♂, Umgebung Dscharkent (bei Kuldscha, Ili-Gebiet, Russisch Turkestan) (Rück- beil leg.) ( ZSM) . Allotypus: 1 ♀, Kuldscha (Ili- Gebiet) (Rückbeil leg.) ( ZSM) . Paratypes: 2 ♂♂, Dscharkent (bei Kuldscha, Ili-Gebiet) (Rückbeil leg.) ( ZSM and Coll. Boursin) . 1 ♂, Ak-su (chinesisch Turkestan), 1910 (Rückbeil leg.), ( ZMHU) (examined) (pl. 11, figs. 2, 3).

Redescription (pl. 11). Forewing length 10–20 mm. Forewing gray (from light to dark tone), with three thin dark lines: marginal, postmedial and basal. Postmedial line in its main part curved externally, so its shape looks like a reversed letter “c”. Discal and discoidal kidney-shaped spots poorly visible, but always present, located between postmedial and basal lines; the limits of these spots can be unclear so the spots can look incomplete. Basal area of the forewing can be little bit darker than other parts of it; sometimes basal area can look like several darker spots with unclear borders. Hindwing lighter than forewing, light-grey to white (rarely), marginal area of the hindwing darker. Veins of the hindwing have slight suffusion of dark scales. Discal spot is a bit darker than ground color, vformish, thin. Fringes of the same color as the wings ground color. In general, the species is not variable in its wing pattern and ground color except its lighter eastern populations; the only variability which can be recorded for this species located in the specimens’ size.

Male genitalia (pl. 12). Tegumen helmet-like, uncus thin, C-shaped, with sharp apex, as long as the tegumen. Valva long, with rounded and wide apex, tapering medially. Harpa located in the area of narrowing, it is slightly more sclerotized than the valva , pear-shaped, wider in its basal part. Aedeagus about 40–50% of the valva length, cone-shaped (wider in its apex). Apical part of the aedeagus with a field of short spikes located in its dorsal side. Everted vesica with two diverticulums: frontal, bag-shaped, with long well sclerotized spike on its apex, and caudal, long and thin (2 and more times longer than aedeagus). The male genitalia variability was not found.

Female genitalia (pl. 13). Uniform in its structure, variability is very weak (in general, only in size). Papillae anales relatively short, shorter than its width. Apophyses anteriores and posteriores are thin, almost same in size, about 15-20% longer than papilla analis. Postvaginal plate well sclerotized, in the shape of a bowl. Antrum long and thin, with two sclerotized folds of full antrum length; on the sides of these folds (they look more like cornuti) located narrow fields of small sclerotized dots. Ductus bursae pear-shaped, not sclerotized.

Subspecies and variability. There is no enough variability to determine any subspecies in the species area.

Material examined. China. Paratype ♂, Aksu ( ZMHU) . Kazakhstan. 4 ♂, 2 ♀, 7.07.201 5, Boguty Mts., Chingelsu valley , N43° 34.825’ E78° 39.847’, 851 m (Korb) ( SK) GoogleMaps ; 1 ♂, 30.06.201 5, Transili Alatau Mts., near Koram , N43° 29.358’ E78° 10.242’, 787 m (Korb) ( SK) GoogleMaps ; 16 ♂, 2 ♀, 10.07.201 5, Transili Alatau Mts. , near Almaty, N43° 06.108’ E76° 56.119’, 1583 m (Korb) ( SK) GoogleMaps ; 3 ♂, 2 ♀, 30.06.201 1, Boro-Khoro Mts. , 8 km N of Sarymbel, N44° 29.765’ E80° 03.848’, 1830 m (Korb) ( SK) GoogleMaps ; 6 ♂, 2 ♀, 20.06.201 7, Boro-Khoro Mts., Usek river valley, N44° 28.082’ E79° 49.760’, 1260 m (Korb) ( SK) GoogleMaps . Kyrgyzstan. 3 ♂, 12.07.201 5, Bishkek environs, Kok-Jar , 800 m, N 42° 49.629’ E 74° 41.116’ (Korb) ( SK) GoogleMaps ; 3 ♂, 6.08.201 5, Bishkek environs, Arashan , 1500 m, N 42° 45.274’ E 74° 38.001’ (Korb) ( SK) GoogleMaps ; 12 ♂, 26.07.201 9, Talassky Mts. , 5,44 km NWW of Cheleke vill., 1926 m, N 42.413 146, E 72.860 289 (Korb) ( SK) GoogleMaps ; 6 ♂, 9 ♀, 27- 28.07.2019, Talas Mts., Kara-Buura river , 31 km S of Kluchevka, 1707 m, N 42.337 976, E 71.607 27 (Korb) ( SK) GoogleMaps ; 2 ♂, 2 ♀, 26.07.201 7, Suusamyrtoo Mts. , 4 km N of Kyzyl-Oi, 1808 m, N41° 59.211’ E74° 09.396’ (Korb) ( SK) GoogleMaps ; 4 ♂, 2 ♀, 13.07.201 5, Fergansky Mts., S shore of Toktogul reservoir, 1768 m, N41° 43.223’ E72° 57.165’ (Korb) ( SK) GoogleMaps ; 10.07.201 4, 8 ♂, 8 ♀, Moldo-Too Mts., Koro-Goo Pass , 1997 m, N41° 31.303’ E74° 45.824’ (Korb) ( SK) GoogleMaps ; 2 ♂, 2 ♀, 13.07.201 6, Kyrgyzstan, Fergansky Mts. , 11 km SE of Tortkol, 1218 m, N41° 41.161’ E72° 58.459’ (Korb) ( SK) GoogleMaps ; 3 ♂, 3 ♀, 14.07.201 5, Alai Mts., valley between Tashkoro and Kara- bulak, 1805 m, N40° 14.119’ E73° 24.484’ (Korb) ( SK) GoogleMaps . Tajikistan. 12 ♂, 5 ♀, 15.07.201 1, Tajikistan, Zangerya kishlak environs, 1130 m, N38° 18.485’ E70° 36.216’ (Korb) ( SK) GoogleMaps .

Distribution. Widely distributed in Central Asia: Dzhungarian Alatau Mts. and Boro-Khoro Mts., Boguty and Syugaty Mts., Tian-Shan, northern slope of Alai Mts., Gissar, Darvaz and West Pamir.

Ecology. Prefer lowlands and middle mountains (dry steppes and meadows in the places with low vegetation), vertical zone from 800 to 2000 m.

PL. 12. Bryophila rueckbeili Boursin, 1953 , male genitalia. 1, 2, 6, 7: 29.07.201 9, Kyrgyzstan, Suusamyrtoo Mts., Kekemeren river valley, 12 km S of Kojomkul, 42.046 225 N,74.154575 E, 1874 m (Korb). 3, 5: 10.07.201 5, Transili Alatau Mts., near Almaty, N43° 06.108’ E76° 56.119’, 1583 m (Korb). 4: 7.07.201 5, Boguty Mts., Chingelsu valley, N43° 34.825’ E78° 39.847’, 851 m (Korb). 8: 8.08.201 4, Kyrgyzstan, Bishkek environs, Kok-Jar, 800 m (Korb). 9: 14.07.201 5, Alai Mts., valley between Tashkoro and Karabulak, 1805 m, N40° 14.119’ E73° 24.484’ (Korb). 1, 2, 5: frontal view; 3, 4, 6 – 9: aedeagus, vesica everted. Slides: 1, 3: SK0026 ; 2, 5: SK0333 ; 4: SK0340 ; 6: SK0039 ; 7: SK0040 ; 8: SK0325 ; 9: SK0332 .

PL. 13. Bryophila rueckbeili Boursin, 1953 , female genitalia. 1, 2: 29.07.201 9, Kyrgyzstan, Suusamyrtoo Mts. , Kekemeren river valley, 12 km S of Kojomkul, 42.046 225 N,74.154575 E, 1874 m (Korb), SK0025 ; SK0036 . 3, 4: 27- 28.07.2019, Talas Mts. , Kara-Buura river, 31 km S of Kluchevka, 1707 m, N 42.337 976, E 71.607 27 (Korb), SK0038 GoogleMaps ; SK0136 GoogleMaps . 5, 8: 15.07.201 1, Tajikistan, Zangerya kishlak environs, 1130 m, N38° 18.485’ E70° 36.216’ (Korb), SK0326 GoogleMaps ; SK0331 GoogleMaps . 6: 7.07.201 5, Boguty Mts. , Chingelsu valley, N43° 34.825’ E78° 39.847’, 851 m (Korb), SK0359 GoogleMaps . 7: 13.07.201 6, Kyrgyzstan, Fergansky Mts. , 11 km SE of Tortkol, 1218 m, N41° 41.161’ E72° 58.459’ (Korb), SK0321 GoogleMaps . 9: 25.07.201 6, Dzhumgaltoo Mts. , 2 km N of Kojomkul, 2080 m, N42° 09.141’ E74° 04.131’ (Korb), SK0337 GoogleMaps . 10: 26.07.201 6, Suusamyrtoo Mts. , 4 km N of Kyzyl-Oi, 1808 m, N41° 59.211’ E74° 09.396’ (Korb), SK0338 GoogleMaps .

PL. 14. Bryophila raptricula ([Denis et Schiffermüller], 1775), upperside and labels. 1, 2: B. raptricula aksuensis f. dolopis ( Hampson, 1908) , type specimen. 3: 20.06.201 7, Boro-Khoro Mts., Usek river valley, N44° 28.082’ E79° 49.760’, 1260 m (Korb), SK0299 ( MT293776 View Materials ). 4, 5: B. raptricula aksuensis f. pallidior Draudt, 1931, type specimen. 6: B. raptricula aksuensis f. pallidior Draudt, 1931, 27- 28.07.2019, Talas Mts., Kara-Buura river, 31 km S of Kluchevka, 1707 m, N 42.337 976, E 71.607 27 (Korb), SK0149. 7, 8: B. raptricula aksuensis f. striata Draudt, 1931, type specimen. 9: B. raptricula aksuensis f. striata Draudt, 1931, Margelan, ZMHU. 10, 14, 24: 29.07.201 9, Kyrgyzstan, Suusamyrtoo Mts., Kekemeren river valley, 12 km S of Kojomkul, 42.046 225 N,74.154575 E, 1874 m (Korb), SK0307 ( MT293782 View Materials ); SK0047; SK0132. 11: 2.06.201 7, Kazakhstan, sand dunes near Ili river 6 km SE of Aidarly, 508 m (Korb), SK0329. 12: 30.06.201 5, Transili Alatau Mts., near Koram, N43° 29.358’ E78° 10.242’, 787 m (Korb), SK0279. 13: 25.07.201 9, Kyrgyzstan, Fergansky Mts., Kara-Suu river coast, 1232 m, N 41.685 956 E 72.974 411 (Korb), SK0291 ( MT293788 View Materials ). 15, 21: 27- 28.07.2019, Talas Mts., Kara-Buura river, 31 km S of Kluchevka, 1707 m, N 42.337 976, E 71.607 27 (Korb). 16: 1- 10.08.2015, Kazakhstan, Taldykorgan (Belousov). 17: 13.07.201 6, Fergansky Mts., 11 km SE of Tortkol, 1218 m, N41° 41.161’ E72° 58.459’ (Korb), MT293802 View Materials . 18: 24.07.201 9, Kyrgyzstan, Fergansky Mts., Kara-Suu river coast, 1232 m, N 41.685 956 E 72.974 411 (Korb), SK0158. 19: 10.07.201 4, Moldo-Too Mts., Koro-Goo Pass, 1997 m, N41° 31.303’ E74° 45.824’ (Korb), SK0286. 20: 4- 6.07.2015, Boro-Khoro Mts., Usek river valley, N44° 28.082’ E79° 49.760’, 1260 m (Korb), SK0285. 22: 23.06.201 6, Kazakhstan, Dzhungarian Alatau Mts., Tekeli, 1550 m (Belousov), SK0309. 23: 20.06.201 7, Boro-Khoro Mts., Usek river valley, N44° 28.082’ E79° 49.760’, 1260 m (Korb), MT293777 View Materials . Subspecies: B. raptricula aksuensis Boursin, 1954: 1–9 , 11–13, 15–17, 20–23; B. raptricula montanotricula Korb , ssp. n.: 10, 14, 19, 24.

PL. 15. Bryophila raptricula ([Denis et Schiffermüller], 1775), uppersides. 1: 23.06.201 6, Kazakhstan, Dzhungarian Alatau Mts., Tekeli (Belousov), SK0308. 2, 11: 13.07.201 5, Fergansky Mts., S shore of Toktogul reservoir, 1768 m, N41° 43.223’ E72° 57.165’ (Korb), SK0290; SK0283. 3: 3.07.201 0, Bridge on Ili river near Koktal, N43° 58.004’ E79° 35.905’, 600 m, SK0289. 4, 9: 7.07.201 5, Boguty Mts., Chingelsu valley, N43° 34.825’ E78° 39.847’, 851 m (Korb), SK0288; SK0287. 5: 11.07.201 6, Dzhumgaltoo Mts., 2 km N of Kojomkul, 2080 m, N42° 09.141’ E74° 04.131’ (Korb), MT293800 View Materials . 6, 7: 20.07.201 7, Fergansky Mts. near Urum-Bash, 1655 m, N41° 11.121’ E73° 22.812’ (Korb), MT293792 View Materials ; MT293797 View Materials . 8: 3- 8.07.2018, Katta-Kaindy Mts., 8.5 km S of Englchek, 2509 m, N 41°57’518 E 79° 7’782 (Korb), MT293798 View Materials . 10: 30.06.201 5, Transili Alatau Mts., near Koram, N43° 29.358’ E78° 10.242’, 787 m (Korb), SK0284. 12: 26.07.201 6, Kyrgyzstan, Suusamyrtoo Mts., Kekemeren river valley, 12 km S of Kojomkul, 42.046 225 N,74.154575 E, 1874 m (Korb), SK0282. 13: 5.06.201 7, Kazakhstan, Ili river valley, desert and dunes 8,5 km N of Dubin, 519 m (Korb), SK0281. 14: 8.08.201 4, Kyrgyzstan, Kyrgyzski Mts., 4 km S of Kok-Jar, 1200 m (Korb), SK0280. 15: 4- 6.07.2015, Boro-Khoro Mts., Usek river valley, N44° 28.082’ E79° 49.760’, 1260 m (Korb), SK0267. 16: 24.07.201 9, Kyrgyzstan, Fergansky Mts., Kara-Suu river coast, 1232 m, N 41.685 956 E 72.974 411 (Korb), SK0169. 17, 18, 19, 23, 24: 29.07.201 9, Kyrgyzstan, Suusamyrtoo Mts., Kekemeren river valley, 12 km S of Kojomkul, 42.046 225 N,74.154575 E, 1874 m (Korb), SK0135; SK0134; SK0132; SK0305 ( MT293784 View Materials ); SK0045. 20: 3- 8.07.2018, Katta-Kaindy Mts., 8.5 km S of Englchek, 2509 m, N 41°57’518 E 79° 7’782 (Korb), MT293801 View Materials . 21, 22: 20.06.201 7, Boro-Khoro Mts., Usek river valley, N44° 28.082’ E79° 49.760’, 1260 m (Korb), SK0300 ( MT293775 View Materials ); SK0297 ( MT293777 View Materials ). Subspecies: B. raptricula aksuensis Boursin, 1954: 1–4 , 6, 7, 9–11, 13–16, 21, 22; B. raptricula montanotricula Korb , ssp. n.: 5, 8, 12, 17–20, 23, 24. Scale bar: 1 cm.

PL. 16. Bryophila raptricula ([Denis et Schiffermüller], 1775), male genitalia. 1, 3: 2.06.201 7, Kazakhstan, sand dunes near Ili river 6 km SE of Aidarly, 508 m (Korb), SK0329 (f. dolopis ). 2, 5: 25.07.201 9, Kyrgyzstan, Fergansky Mts., Kara-Suu river coast, 1232 m, N 41.685 956 E 72.974 411 (Korb), SK0291 ( MT293788 View Materials ). 4: 20.06.201 7, Bridge on Ili river near Koktal, N43° 58.004’ E79° 35.905’, 600 m, SK0297 ( MT293777 View Materials ). 6, 7, 8: 29.07.201 9, Kyrgyzstan, Suusamyrtoo Mts., Kekemeren river valley, 12 km S of Kojomkul, 42.046 225 N,74.154575 E, 1874 m (Korb), SK0047; SK0134. 9: 27- 28.07.2019, Talas Mts., Kara-Buura river, 31 km S of Kluchevka, 1707 m, N 42.337 976, E 71.607 27 (Korb), SK0149 (f. pallidior). 10, 11: 24.07.201 9, Kyrgyzstan, Fergansky Mts., Kara-Suu river coast, 1232 m, N 41.685 956 E 72.974 411 (Korb), SK0169. 12, 13: 4- 6.07.2015, Boro-Khoro Mts., Usek river valley, N44° 28.082’ E79° 49.760’, 1260 m (Korb), SK0267; SK0285. 14: 8.08.201 4, Kyrgyzstan, Kyrgyzski Mts., 4 km S of Kok-Jar, 1200 m (Korb), SK0280. Subspecies: B. raptricula aksuensis Boursin, 1954: 1–5 , 9–14; B. raptricula montanotricula Korb , ssp. n.: 6–8.

PL. 17. Bryophila raptricula ([Denis et Schiffermüller], 1775), female genitalia. 1, 3, 4, 9: 29.07.201 9, Kyrgyzstan, Suusamyrtoo Mts., Kekemeren river valley, 12 km S of Kojomkul, 42.046 225 N,74.154575 E, 1874 m (Korb), sample 2019-025, slide SK0307; sample KORB2019-027, slide SK0305; SK0132; SK0043. 2: 20.06.201 7, Boro-Khoro Mts., Usek river valley, N44° 28.082’ E79° 49.760’, 1260 m (Korb), sample 2019-013, slide SK0299. 5: 30.06.201 5, Transili Alatau Mts., near Koram, N43° 29.358’ E78° 10.242’, 787 m (Korb), slide SK0279. 6: 26.07.201 6, Kyrgyzstan, Suusamyrtoo Mts., Kekemeren river valley, 12 km S of Kojomkul, 42.046 225 N,74.154575 E, 1874 m (Korb), slide SK0282. 7: 10.07.201 4, Moldo-Too Mts., Koro-Goo Pass, 1997 m, N41° 31.303’ E74° 45.824’ (Korb), slide SK0286. 8: 7.07.201 5, Boguty Mts., Chingelsu valley, N43° 34.825’ E78° 39.847’, 851 m (Korb), slide SK0288. 10: 13.07.201 5, Fergansky Mts., S shore of Toktogul reservoir, 1768 m, N41° 43.223’ E72° 57.165’ (Korb), slide SK0290. Subspecies: B. raptricula aksuensis Boursin, 1954: 2 , 5, 8, 10; B. raptricula montanotricula Korb , ssp. n.: 1, 3, 4, 6, 7, 9.

PL. 18. Bryophila istaravshana Pekarsky, 2020 and B. felina (Eversmann, 1852) , genitalia and upperside. B. istaravshana Pekarsky, 2020 . 1–5: male genitalia (1, 4: frontal view; 2, 3, 5: aedeagus, vesica everted), 6: female genitalia. Slides: 1, 2, 3: SK0327 (paratype); 4, 5 : SK0323 ; 6 : SK0324 (paratypes). B. felina (Eversmann, 1852) . 6, 7: lectotype and its genitalia. 8: female genitalia, Khorog . Photos: 1–5 by the author, 6–8 by A.Y. Matov .

Bryophila istaravshana ( Pekarsky, 2020) , comb.n. (pl. 7, figs 21–24; pl. 18; pl. 22, fig. 2)

Pekarsky, 2020: 97–98; figs 5, 6, 11, 12 ( Scythobrya istaravshana ).

Type locality: “ Tajikistan, Turkestan Mt. Range , Istaravshan Distr., 15 km SW Ovchi, 2865 m, N39°31’10’’, E68°55’26’’ ” (by original description) GoogleMaps .

Type material: Holotype: 1 ♂, Tajikistan, Turkestan Mt. Range , Istaravshan Distr., 15 km SW Ovchi, 2865 m, N39°31’10’’, E68°55’26’’ (leg. O. Pak & E. Ivanova), (slide OP 4433m) (coll. O. Pekarsky) GoogleMaps . Paratypes: Tajikistan: 3♂♂, 2♀♀, with the same data as the Holotype (coll. O. Pekarsky) GoogleMaps ; 1♀, Gissarsky ridge, riv. Kofernigan, kishlak Yavroz, 31.VIII.[19]91, leg. S.F. Melyakh , slide OP1637f (coll. O. Pekarsky); 1♀, 20 km N Dushanbe , vill. Varzob, 1200 m, 18.VII.2010, leg. O. Pak (coll. O. Pekarsky) ; 4♂♂, 3♀♀, Darvazsky Mts , 10,45km SW of Padkinov kish- lak on Afghanistan-Tajikistan border (Pyandzh river), 1130 m, N38°18’485, E70°36’216, 15.07.201 1, leg. S. Korb , slides OP 1749m, OP1748f (coll. O. Pekarsky); 8♂♂, 6♀, with the same locality and data ( SK) ; 8♂♂, 3♀♀, with the same locality and data, leg. A. Nikolayev (coll. O. Pekarsky) ; 5 ♂♂, 2 ♀♀, 13.VII.2015, Fergansky Mts, S shore of Toktogul reservoir, 1768 m, N41° 43.223’ E72° 57.165’ GoogleMaps ; 2 ♂♂, 1 ♀, 27–28.VII.2019, Talas Mts , Kara-Buura river, 31 km S of Kluchevka, 1707 m, N 42.337 976, E 71.607 27 ( SK) (part of paratypes examined, see below) GoogleMaps .

Material examined. Paratypes: 8 ♂, 6 ♀, 15.07.201 1, Tajikistan, Zangerya kishlak environs, 1130 m, N38° 18.485’ E70° 36.216’ (Korb) ( SK) GoogleMaps ; Kyrgyzstan, 5 ♂, 2 ♀, 13.07.201 5, Fergansky Mts. , S shore of Toktogul reser- voir, 1768 m, N41° 43.223’ E72° 57.165’ (Korb) ( SK) GoogleMaps ; 2 ♂, 1 ♀, 27- 28.07.2019, Talas Mts. , Kara-Buura river, 31 km S of Kluchevka, 1707 m, N 42.337 976, E 71.607 27 (Korb) ( SK) GoogleMaps .

Distribution. The species seemed to be very local, but in its habitats it is quite common. It is confirmed to the following areas: Darvazsky (near Padkinov kishlak), Gissarsky (Varzob valley) and Turkestansky (Istaravshan distr.) mountain ranges in Tajikistan and Talassky (Kara-Buura river valley) and Fergansky (south shore of the Toktogul reservoir) mountain ranges in Kyrgyzstan.

Ecology. Prefer dry biotopes in the middle mountains, vertical zone from 1100 to 2000 m (pl. 23, fig. 1).

Bryophila raptricula ([Denis et Schiffermüller], 1775)

Denis & Schiffermüller 1775: 89 (N.[octua] Raptricula).

Type locality: “ Wienergegend ” (Vienna area) (by original description) .

Type material: lost.

= dolopis Hampson 1908: 645 View in CoL ; pl. 122, fig. 30 ( Bryophila dolopis ).

Type locality: “ W. Turkestan, Askabad, Kuschk” (by original description) .

Type material: holotype (by monotypy), ZMHU, examined (pl. 14, figs 1, 2). A specimen labelled: “Type | dolopis Hmpsn. ♂ ” (pink paper, first line printed, second line handwritten); two-sided: “ Asia centr. | Askabad kuschk.” (one side, first line printed, second line handwritten), “5/05 v. R. Tancré ” (other side, handwritten) (white paper); “GART | specimen ID: | 06485 | Exemplar + Etiketten | dokumentiert | specimen + label | data documented | 5.12.2003 ” (yellow label, printed, last line partially handwritten); “coll. ZMHU Berlin | slide No. RL10123 | L. Ronkay, 2010” (printed, white paper) .

= pallidior Draudt 1931: 15; pl. 2, fig. c ( Bryophila dolopis f. pallidior).

Type locality: not stated. By syntype: “Issyk-Kul”.

Type material: amount of type specimens not stated, but according the original description it is more than one specimen: “… pallidior f.n. nenne ich Stücke ohne…” <…as pallidior f.n. I name the specimens without…>. One syntype found in ZMHU, examined (pl. 14, figs 4, 5). A specimen labelled: “Type | Bryophila | dolopis Pglr. | pallidior Drd.” (pink paper, handwritten); “von Tancre als | dolopis Hamps – best | gehört wohl zu | Br. raptricula ” (white paper, handwritten); “Issyk-Kul | Rückbeil ges. | Coll. Tancré” (handwritten, white paper); “coll. ZMHU Berlin | slide No. RL10124 | L. Ronkay, 2010” (white paper, printed).

= striata Draudt 1931: 15, pl. 2, fig. e ( Bryophila dolopis f. striata).

Type locality: not stated. By syntype: “ Aksu ”.

Type material: amount of type specimens not stated, so I use assumption that it was more than one. One syn- type found in ZMHU, examined (pl. 14, figs 7, 8). A specimen labelled: “ Type | Bryophila | dolopis Pglr. | striata Drd.” (pink paper, handwritten); “ Aksu | Rückbeil ges. | Coll. Tancré ” (white paper, handwritten); “coll. ZMHU Berlin | slide No. RL10125 | L. Ronkay, 2010” (white paper, printed) .

Subspecies and variability. The species is highly variable. Described as separate species, taxon dolopis (and also its aberrations pallidior and striata) by its DNA (pl. 24) and by the male genitalia belong to B. raptricula . The taxa pallidior and striata were described as infrasubspecific forms and due this reason cannot be used in the zoological nomenclature. On the phylogenetic tree two well separated clusters for this species are present: the cluster belonging to the nominate subspecies (in Central Asia it contains the samples from North and West Tian-Shan, Dzhungaria and Alai) and the cluster which formed by samples from Central and Inner Tian-Shan. The specimens from the last one differs quite nicely from another ones by the wing coloration (it is more grey) and by some features of the wing pattern. I decided to describe herein these specimens as a new subspecies. Some specimens have features more characteristic to B. felina (Eversmann, 1852) ( dolopis -like ones) and due to this reason this species was many times recorded from Central Asia. It must be widely rechecked for the mountainous Central Asia. The subspecies aksuensis Boursin, 1954, described as ssp. of B. orthogramma Boursin, 1954 , belong in fact to B. raptricula and it is confirmed by the DNA analysis.

Distribution. Europe, Kazakhstan, Central Asia (partially), Korean Peninsula and southern part of Russian Far East. In Central Asia this species is widely distributed in Kazakhstan (including desert areas of Central and West Kazakhstan), Kyrgyzstan and North Tajikistan (only in some localities within the Turkestansky mountain ridge).

Ecology. Very flexible species, can occupy a wide range of habitats from deserts and semideserts to wet mountainous meadows, but prefers steppes and dry meadows (pl. 23, figs 1–4, 7, 8). Vertical zone from 500 to 2000 m.

Bryophila raptricula aksuensis (Boursin, 1954)

(pl. 14, figs 1–9, 11–13, 15–17, 20–23; pl. 15, figs 1–4, 6, 7, 9–11, 13–16, 21, 22; pl. 16, figs 1–5, 9–14; pl. 17, figs 2, 5, 8, 10)

Boursin 1954a: 83; Taf. 5, Fig. 5 ( Cryphia orthogramma aksuensis View in CoL n. f. an ssp.).

Type locality: “ Aksu ( Chinesisch-Turkestan )” (by original description) .

Type material: holotype ♂, Coll. Schwingenschuss, paratypes 1 ♂, 3 ♀, ZMHU , examined.

Redescription (pl. 14, 15). Forewing length 11–16 mm. Wings ground color grey, darker on the forewing. Forewing pattern: black marginal stripe near the anal edge; poorly visible oval or kidney-shaped discal and discoidal spots (discal spot can be almost completely reduced); v-shaped discal line formed by darker (outside) and lighter (inside) parts; submarginal c-shaped line formed by darker (inside, better visible) and lighter (outside, poorly visible) parts, normally this line does not hit the costal border of the forewing. Darker and lighter unclear spots can be present on the forewing surface, especially in its marginal and basal parts. Hindwing unicolorous, grey, sometimes with dark suffusion on the veins. Fringes one-colored, same tone as the wings ground color.

Male genitalia (pl. 16, figs 1–5, 9–14). Tegumen triangular with rounded apex. Uncus about 60% of the length of the tegumen, cylindrical, with pointed apex. Juxta triangular. Valva pear-shaped, its basal part is thin, rounded caudal part is relatively wide (2.5–3.0 times wider than its basal part); harpa cog-shaped, with pointed apex, short (about 30% of the valva length). Aedeagus short, 3–4 times shorter than valva , cylindrical, straight. Everted vesica bag-shaped, its caudal diverticulum long, triangular; vesica with sclerotized cornutus on its medium part.

Female genitalia (pl. 17, figs 2, 5, 8, 10). Papillae analesvery short, at least two times shorter than its width. Apophyses anterioris and posterioris are thin, anteriores are longer than posteriors in about 10–20%, much longer than papilla analis (two or more times). Postvaginal plate medium-sclerotized, C-shaped. Antrum long and thin, with sclerotized basal plate; the clerotized folded area is located in its caudal part. Ductus bursae long-oval, not sclerotized.

Material examined. China. 2 ♂, 3 ♀, Aksu (holotype and paratypes) . Kazakhstan. 2 ♂, 2 ♀, 1- 10.08.2015, Taldykorgan ( Belousov ) ( SK) ; 2 ♂, 2.08.201 8, 32 km NW of Bakanas, N44° 53.940’ E75° 53.479’, 377 m ( Korb ) ( SK) GoogleMaps ; 3 ♂, 3 ♀, 20.06.201 7, Boro-Khoro Mts., Usek river valley, N44° 28.082’ E79° 49.760’, 1260 m ( Korb ) ( SK) GoogleMaps ; 2 ♂, 2 ♀, 20.06.201 0, Boro-Khoro Mts., 8 km N of Sarymbel, N44° 29.765’ E80° 03.848’, 1830 m ( Korb ) ( SK) GoogleMaps ; 16 ♂, 20 ♀, 3.07.201 0, Bridge on Ili river near Koktal , N43° 58.004’ E79° 35.905’, 600 m GoogleMaps ; 1 ♀, 22.06.201 0, Near Chingeldy, N44° 00.151’ E77° 28.890’, 509 m ( Korb ) ( SK) GoogleMaps ; 1 ♂, 3.08.201 8, Altyn-Emel Nature Reserve, Singing Dunes, N43° 50.273’ E78° 35.759’, 467 m ( Korb ) ( SK) GoogleMaps ; 2 ♀, 16.07.201 0, Charyn Relic Forest, N43° 38.124’ E79° 21.641’, 638 m ( Korb ) ( SK) GoogleMaps ; 6 ♂, 1 ♀, 7.07.201 5, Boguty Mts., Chingelsu valley, N43° 34.825’ E78° 39.847’, 851 m ( Korb ) ( SK) GoogleMaps ; 2 ♂, 2 ♀, 30.06.201 5, Transili Alatau Mts., near Koram, N43° 29.358’ E78° 10.242’, 787 m ( Korb ) ( SK) GoogleMaps ; 22 ♂, 21 ♀, 10.07.201 5, Transili Alatau Mts., near Almaty, N43° 06.108’ E76° 56.119’, 1583 m ( Korb ) ( SK) GoogleMaps ; 2 ♂, 3 ♀, 29.07.201 0, 64 km E of Taraz, N42° 59.061’ E72° 11.012’, 657 m ( Korb ) ( SK) GoogleMaps . Kyrgyzstan. 263 ♂, 205 ♀, 1- 30.07.2009 -2019, Bishkek environs, Kok-Jar, 800 m, N 42° 49.629’ E 74° 41.116’ ( Korb ) ( SK) GoogleMaps ; 2 ♂, 3 ♀, 6.08.201 5, Bishkek environs, Arashan, 1500 m, N 42° 45.274’ E 74° 38.001’ ( Korb ) ( SK) GoogleMaps ; 2 ♂, 2 ♀, 24.07.201 4, Bishkek environs, Ala-Archa National Park, 2400 m, N 42° 32.316’ E 74° 28.884’ ( Korb ) ( SK) GoogleMaps ; 1 ♂, 2.07.201 8, Terskey Ala-Too Mts., 4,5 km S of Teplokluchenka, 2039 m, N42° 27.441’ E78° 31.592’ ( Korb ) ( SK) GoogleMaps ; 9 ♂, 4 ♀, 8.07.201 6, South shore of Issyk-Kul lake, 6,6 km E of Kara-Talaa, 1591 m, N42° 18.281’ E76° 28.904’ ( Korb ) ( SK) GoogleMaps ; 3 ♂, 2 ♀, 26.07.201 9, Talassky Mts., 5,44 km NWW of Cheleke vill., 1926 m, N 42.413 146, E 72.860 289 ( Korb ) ( SK) GoogleMaps ; 13 ♂, 5 ♀, 27- 28.09.2019, Talas Mts., Kara-Buura river, 31 km S of Kluchevka, 1707 m, N 42.337 976, E 71.607 27 ( Korb ) ( SK) GoogleMaps ; 1 ♀, 29.07.201 6, Baidulu Mts., Dolon Pass, 2700 m, N41° 50.426’ E75° 44.451’ ( Korb ) ( SK) GoogleMaps ; 12 ♂, 13.07.201 5, Fergansky Mts., S shore of Toktogul reservoir, 1768 m, N41° 43.223’ E72° 57.165’ ( Korb ) ( SK) GoogleMaps ; 2 ♂, 15.07.201 9, Dzhalal-Abad Prov., 2 km W Burgondu vill., 611 m, 41.042 682 N,72.289465 E ( Korb ) ( SK) .

Distribution. In Central Asia: Kazakhstan (including desert areas of Central and West Kazakhstan), Dzhungarian Alatau Mts. and Boro-Khoro Mts., Kyrgyzstan (North and West Tian-Shan, Alai, North Gissar) and North Tajikistan (only in some localities within the Turkestansky mountain ridge).

Bryophila raptricula montanotricula Korb , ssp. n.

(pl. 14, figs 10, 14, 19, 24; pl. 15, figs 5, 8, 12, 17–20, 23, 24; pl. 16, figs 6–8; pl. 17, figs 1, 3, 4, 6, 7)

Description (pl. 14, figs 10, 14, 19, 24; pl. 15, figs 5, 8, 12, 17–20, 23, 24). Forewing length 12–16 mm. Wings ground color grey, darker on the forewing. Forewing pattern: black marginal stroke near the anal edge; poorly visible rounded discal and discoidal spots (discal spot can be almost completely reduced); s-shaped discal line formed by darker (outside) and lighter (inside) parts; submarginal c-shaped line formed by darker (inside, better visible) and lighter (outside, poorly visible) parts. Darker and lighter unclear spots can be present on the forewing surface, especially in its marginal and basal parts. Hindwing one-colored, grey, sometimes with dark suffusion on the veins. Fringes one-colored, same tone as the wings ground color.

Male genitalia (pl. 16, figs 6–8). Do not have any differences from the nominate subspecies.

Female genitalia (pl. 17, figs 1, 3, 4, 6, 7, 9). Do not have any differences from the nominate subspecies.

Material examined. Kyrgyzstan. Holotype ♂, 7.07.201 8, 3- 8.07.2018, Katta-Kaindy Mts. , 8.5 km S of Englchek, 2509 m, N 41°57’518 E 79° 7’782 (Korb) ( MT 293798 View Materials ) (pl. 15, fig. 8) ( ZISP) . Paratypes: 12 ♂, 5 ♀, 3- 8.07.201 8, same data as holotype (Korb) ; 4 ♂ 9.07.201 4, Kyrgyzstan , Suusamyrtoo Mts., river Kekemeren valley, N 41° 59.211’ E 74° 9.396’, 1808 m (Korb) GoogleMaps ; 23 ♂, 12 ♀, 10.07.201 4, Kyrgyzstan , Moldo-Too Mts., near Koro-Goo Pass, N 41 ° 31.303’ E 74 ° 45.824’, 1997 m (Korb) GoogleMaps ; 1 ♂, 11.07.201 6, Kyrgyzstan , Dzhumgaltoo Mts., Sary-Kaiky Mts., 42.190 05 N,74.05321 E, 2107 m (Korb) ; 3 ♂, 1 ♀, 26.07.201 6, Kyrgyzstan , Suusamyrtoo Mts., Kekemeren river valley, 3,6 km N of Kyzyl-Oi, N 41° 59.211’ E 74° 9.396’, 1808 m (Korb) GoogleMaps ; 12 ♂, 29.07.201 9, Kyrgyzstan , Suusamyrtoo Mts., Kekemeren river valley, 12 km S of Kojomkul, 42.046 225 N,74.154575 E, 1874 m (Korb) (pl. 14, figs 10, 14, 19, 24; pl. 15, figs 5, 12, 17–20, 23, 24) ( ZISP, SK) .

Molecular data. The holotype CO1 sequence ( MT 293798 View Materials ) :

AACATTATATTTTATTTTTGGAATTTGAGCTGGAATAGTAGGAACTTCATTAAGATTATTAATTC- GTGCTGAATTAGGAACCCCCGGATCTTTAATTGGAGATGACCAAATTTATAATACTATTGTAACAGCT- CATGCTTTTATTATAATTTTTTTCATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAG TCCCTTTAATATTAGGAGCCCCAGATATAGCTTTCCCTCGAATAAATAATATAAGTTTTTGACTTCTTCCCCCCTCTT- TA A C T T TAT TA AT T T C A A G A A G A AT T G TA G A A A AT G G A G C A G G A A C A G G AT G A A C A G T T- TA C C C C C C A C T T T C AT C TA ATAT T G C T C AT G G A G G TA G C T C A G TA G AT T TA G C TAT T T T T T C T CTTCATTTAGCGGGAATTTCATCTATTTTAGGAGCAATTAATTTTATTACTACTATTATTAACATACGAT- TAAATAGATTATCTTTTGATCAAATACCTCTATTTATTTGAGCTGTAGGGATTACTGCATTTTTATTATTAT-

TATCATTACCTGTTTTAGCTGGAGCTATTACTATACTTTTAACTGATCGAAATTTAAATACATCTTTCTTT- GACCCTGCTGG

Differential diagnosis. Compared to B. raptricula aksuensis . The deep differences found in the CO1 sequence (see the cladogram, pl. 24). No differences in the male and female genitalia have been found. The differences in the wing pattern: forewing submarginal line in the new subspecies almost always destines the costal border of the forewing whereas the same line in the nominate subspecies normally disappear near the middle part of the forewing; brown color on the forewing in the new subspecies (which makes it looking ‘ orthogramma -like’) is very rare, only 3 specimens in whole type series have it, whereas in the nominate subspecies it is quite frequent and can be present in about half of all specimens; discoidal spot on the forewing in the new subspecies is rounded, in the nominate one it is normally oval or kidney-shaped.

Distribution. This subspecies is an endemismus of Inner and Central Tian-Shan; it was recorded from the mountain ridges Katta-Kaindy (Central Tian-Shan), Dzhumgaltoo, Moldo-Too, Suusamyrtoo (Inner Tian-Shan); most likely it is distributed in the mentioned mountainous massifs almost everywhere.

Ecology. Prefer dry habitats: steppes, mountainous semideserts, dry stony slopes. Vertical zone: 1800–2700 m (pl. 23, figs 3, 4).

Etymology. The name origins from the Latin words ‘tricula’ (little toy) and ‘montanus’ (mountainous); it is formed in the likeness of other names of this genus, such as raptricula , receptricula , spoliatricula etc.

Bryophila felina (Eversmann, 1852)

(pl. 18, figs 7–9)

Eversmann, 1852: 156–157 ( Hadena Felina ).

Type locality: “das russische Armenien ” (by original description).

Type material: lectotype, ZISP, examined by photograph ( Fibiger et al. 2010: 250; pl. 18, fig. 41).

Redescription, male and female genitalia. Not needed, due to its presence in the shortly published 12 th volume of the “ Noctuidae Europaeae ” where it was described in details when the lectotype designated. I decided to figure here the images of the lectotype of B. felina , its genitalia and the genitalia of the specimen of this species from Khorog in Tajikistan to illustrate its presence in the mountainous Central Asia.

Note. In the paper where the lectotype of B. felina was designated, the taxon dolopis was synonymized to this species. As I showed in current paper by using molecular data, the taxon dolopis and its allied phenotypes are the synonyms of B. raptricula . The type specimen of B. felina looks pretty close to dolopis , combining the external features of dolopis , pallidior and striata, but by its CO1 sequences all dolopis -like moths were placed into B. raptricula cluster when the B. felina cluster is well separated. The female genitalia of the type specimen of B. felina and B. raptricula from the mountainous Central Asia are close (pl. 18, figs 8, 9; pl. 21) but can be distinguished by the following details: the bursa copulatrix in B. raptricula has no folded structures in its basal part (it is present as long folds in B. felina ) and the postvaginal plate in B. felina is well sclerotized and have the folded borders (in B. raptricula it is almost not sclerotized and its borders are not folded). The female genitalia variability in B. raptricula is quite wide; I expect the same for B. felina , but it must be topic of a special research.

In fact I do not exclude the possibility that B. felina is just one of the wide selection of phenotypes belonging to B. raptricula , but to make final conclusion it must be sequenced from Turkey, Caucasus, Transcaucasus and North Iran to build the complete row of sequences between Europe and Asia.

Material examined. Kyrgyzstan. 2 ♂, 10.07.201 4, Moldo-Too Mts., Koro-Goo Pass , 1997 m, N41° 31.303’ E74° 45.824’ (Korb) ( SK) GoogleMaps ; 1 ♂, 21.07.201 4, Bishkek env., Sarban (Korb) ; 1 ♀, 13.07.201 5, Fergansky Mts., S shore of Toktogul reservoir, 1768 m, N41° 43.223’ E72° 57.165’ (Korb) ( SK) GoogleMaps ; 4 spec.: 13.07.201 6, Za Toktogulom (Korb) ; 22 spec.: 25.07.201 6, Karakol (Korb) ; 12 spec.: 26.07.201 6, Kekemeren (Korb) .

Distribution. According Fibiger et al. (2010), this taxon has Eurasiatic distribution, and it was confirmed in “…Central and Eastern Europe ( Hungary, Croatia, Bulgaria, Ukraine, European Russia – and from Sardinia); out- side Europe it is certainly found in the Caucasus region ( Azerbaijan, Armenia), Turkey (Hakkari) and Lebanon ” ( Fibiger et al. 2010: 250). Recorded from various places of Kyrgyzstan (Korb & Matov 2016; Korb et al. 2016); in Tajikistan it is recorded from the vicinities of Khorog (pl. 17, fig. 9). More or less possible that its geographical range within the mountainous Central Asia is quite wide and coincides the geographical range of B. raptricula .

PL. 19. Cryphia distincta (Christoph, 1887) , C. receptricula (Hübner, [1803]) , uppersides. C. distincta : 1, 13: 8.08.201 4, Kyrgyzstan, Bishkek environs, Kok-Jar, 800 m (Korb), SK0315. 2, 3: Holotype. 4, 5, 7 – 8: 27- 28.07.2019, Talas Mts., Kara- Buura river, 31 km S of Kluchevka, 1707 m, N 42.337 976, E 71.607 27 (Korb), SK0296 ( MT293779 View Materials ); SK0027; SK0028; SK0301. 6: 25.07.201 9, Kyrgyzstan, Fergansky Mts., Kara-Suu river coast, 1232 m, N 41.685 956 E 72.974 411 (Korb), SK0298 ( MT293787 View Materials ). 10: 21.07.201 4, Kyrgyzstan, Bishkek env., Sarban, 1050 m (Korb), SK0311. 11, 12: 13.07.201 6, Kyrgyzstan, Fergansky Mts., 11 km SE of Tortkol, 1218 m, N41° 41.161’ E72° 58.459’ (Korb), SK0313; SK0314. C. receptricula : 14: 26.07.201 4, Kyrgyzstan, Kirgizsky Mts., 4 km S of Kok-Jar, 900 m (Korb), SK0316. 15: 20.07.201 7, Fergansky Mts. near Urum-Bash, 1655 m, N41° 11.121’ E73° 22.812’ (Korb), MT293791 View Materials . 16 – 23: 21.07.201 4, Kyrgyzstan, Bishkek env., Sarban, 1050 m (Korb), SK0375; SK0374; SK0373; SK0372; SK0371; SK0370; SK0369; SK0368. Photos: 1, 4–24 by the author, 2, 3 by A.Y. Matov. Scale bar: 1 cm.

ZMHU

Zoologisches Museum der Humboldt Universitaet

MT

Mus. Tinro, Vladyvostok

ZISP

Zoological Institute, Russian Academy of Sciences

ZSM

Bavarian State Collection of Zoology

Kingdom

Animalia

Phylum

Arthropoda

Class

Insecta

Order

Lepidoptera

Family

Noctuidae

Loc

Bryophila Treitschke, 1825

Korb, Stanislav K. 2020
2020
Loc

Bryophila plumbeola

Draudt, M. 1931: 17
1931
Loc

dolopis

Hampson, G. F. 1908: 645
1908
GBIF Dataset (for parent article) Darwin Core Archive (for parent article) View in SIBiLS Plain XML RDF