Latouchia calcicola Hao, Yu & Zhang, 2025
|
publication ID |
https://doi.org/10.3897/BDJ.12.e137852 |
|
publication LSID |
lsid:zoobank.org:pub:2626A1F9-100B-4C92-9740-6C3DBED9A947 |
|
DOI |
https://doi.org/10.5281/zenodo.14587176 |
|
persistent identifier |
https://treatment.plazi.org/id/5818C014-C5A8-561D-BF90-D1B8B5C03091 |
|
treatment provided by |
|
|
scientific name |
Latouchia calcicola Hao, Yu & Zhang |
| status |
sp. nov. |
Latouchia calcicola Hao, Yu & Zhang sp. nov.
Materials
Type status: Holotype. Occurrence: recordedBy: R. Wen & D. Zhong; sex: male; occurrenceID: 689AB112-C36B-5C5F-977A-82E67476680A; Taxon: scientificName: Latouchia calcicola sp. nov.; Location: country: China; stateProvince: Hainan; county: Changjiang; locality: Qicha Town, Geming Cave ; verbatimElevation: 122 m; verbatimCoordinates: 19.0995 ° N, 109.0238 ° E; Identification: identifiedBy: L. Hao; Event: eventDate: 26 September 2023; Record Level: institutionCode: MHBU-ARA- 10000046; KYUARA # 1977 GoogleMaps
Type status: Paratype. Occurrence: recordedBy: R. Wen & D. Zhong; sex: female; occurrenceID: FBE0DB5F-9524-5198-96B4-604CB23A3656; Taxon: scientificName: Latouchia calcicola sp. nov.; Location: country: China; stateProvince: Hainan; county: Changjiang; locality: Qicha Town, Geming Cave ; verbatimElevation: 122 m; verbatimCoordinates: 19.0995 ° N, 109.0238 ° E; Identification: identifiedBy: L. Hao; Event: eventDate: 26 September 2023; Record Level: institutionCode: MHBU-ARA- 10000047; KYUARA # 1978 GoogleMaps
Type status: Paratype. Occurrence: recordedBy: R. Wen & D. Zhong; sex: female; occurrenceID: 1A17DA56-EA5A-573D-A553-817A0FD3EF62; Taxon: scientificName: Latouchia calcicola sp. nov.; Location: country: China; stateProvince: Hainan; county: Changjiang; locality: Qicha Town, Geming Cave ; verbatimElevation: 122 m; verbatimCoordinates: 19.0995 ° N, 109.0238 ° E; Identification: identifiedBy: L. Hao; Event: eventDate: 26 September 2023; Record Level: institutionCode: MHBU-ARA- 10000048; KYUARA # 2138 GoogleMaps
Description
Male ( Holotype, MHBU-ARA- 10000046). Colouration in ethanol (Fig. 2 View Figure 2 A; for colouration of the living male, see Fig. 1 View Figure 1 C and D). Carapace and chelicerae yellowish-brown, with eye mound, fovea and outer edge of carapace darker; area between eye mound and fovea with two slightly darker longitudinal colour bands. Legs yellowish-brown, with femora gradually transitioning to slightly deeper hue from proximal to distal, darker than rest of legs. Opisthosoma: dorsal side grey, with indistinct dark pattern; ventral side slightly yellower than dorsal side; booklung covers yellower than other ventral areas. Ventral side of whole body generally brighter than dorsal side (Fig. 2 View Figure 2 C); sigilla slightly darker than rest of sternum; chelicerae ventrally more reddish overall.
Total length 11.23. Carapace 5.31 long, 4.55 wide; opisthosoma 5.92 long, 5.12 wide. Eye group 0.55 long, 0.44 wide anteriorly, 0.71 wide posteriorly; MOA 0.47 long, front width 0.36, back width 0.53. Eye diameters and interdistance: AME 0.15, ALE 0.28, PME 0.22, PLE 0.27, AME – AME 0.15, AME – ALE 0.11, ALE – PLE 0.12, PME – PME 0.32, PME – PLE 0.05. Palpal coxa 1.65 long, 1.04 wide, bearing 12 / 13 spinules and 4 / 2 basally thickened bristles on prolateral-proximal corner. Sternum 3.10 long, 2.53 wide. Labium 0.66 long, 0.93 wide, without cuspule or spinule. Chelicerae without stridulatory ridges; rastellum of left and right chelicerae carrying seven and six stout spines, respectively; chelicerae groove with 7 / 7 and 6 / 6 teeth of different sizes on promargin and retromargin, respectively.
Leg formula 4123; measurements: I 15.29 (4.94, 2.13, 3.50, 3.10, 1.62), II 13.14 (4.09, 1.70, 3.01, 2.64, 1.70), III 11.25 (2.98, 1.51, 1.82, 3.16, 1.78), IV 15.53 (4.88, 2.09, 3.97, 2.58, 2.01). Spines on femora to metatarsi of legs I – II straight, sword-like (typical); spines on the prolateral patellae of leg I-II typical, both ventrally with few typical; spines on prolateral tibiae of legs I – II typical, but fewer on leg I than II, ventrally typical and expansive on both legs (Fig. 16 f View Figure 16 f ). Tarsi I – IV spineless. Spination of leg I, patellae, Dpv (1) / (1), Drv (3) / (1), Mpd (1-1 - 1) / (1-1 - 1); tibiae, Dpv (1-1 - 1) / (1-1 - 1 - 2), rv (1-1 - 2 - 1 - 2 - 2 - 2) / (1-2 - 2 - 2 - 2); metatarsi, pv (1-1 - 1 - 1 - 1) / (1-1 - 2 - 1 - 1), rv (1-2 - 1 - 1 - 2 - 1 - 1) / (2-1 - 1 - 1 - 2 - 1). Spination of leg II, patellae, Dpv (1) / (2), Drv (1-2) / (1-2), Mpd (1-1 - 1) / (1-1 - 1); tibiae, Mp (1-2 - 1 - 1) / (1-1 - 1 - 1 - 1), Dpv (1) / (2), Mv (1) / (1), rv (2-2 - 1 - 1 - 1) / (1-1 - 1 - 1 - 1 - 1 - 1); metatarsi, pv (1-1 - 1 - 1 - 1 - 1) / (1-1 - 1 - 1), rv (1-1 - 1 - 1) / (1-1 - 1 - 1). Trichobothria of legs present on proximal one-third part of tibiae I – III, proximal one-fourth part of tibia IV, distal half of metatarsi I – III, distal two-thirds part of metatarsus IV and dorsal side of all tarsi; trichobothria on tibiae I – IV and metatarsi I – IV unmodified; trichobothria on tarsi divided into unmodified and clavate forms, with former irregularly distributed across almost entire dorsal surface and latter only present in proximal half. Count of trichobothria on legs: I, tibia 2 / 2 pd and 2 / 1 rd, metatarsus 6 / 7, tarsus 13 / 14 unmodified and 8 / 8 clavate; II, tibia 5 / 4 pd and 4 / 4 rd, metatarsus 9 / 9, tarsus 10 / 12 unmodified and 8 / 5 clavate; III, tibia 4 / 3 pd and 4 / 4 rd, metatarsus 8 / 9, tarsus 17 / 16 unmodified and 3 / 5 clavate; IV, tibia 4 / 3 pd and 1 / 1 rd, metatarsus 9 / 5, tarsus 9 / 5 unmodified and 3 / 2 clavate. Coxae II – III bear band of spinules on ventro-posterior area. Tarsal claws: paired claws with 3 teeth on tarsi I – III, 3–4 teeth on tarsus IV; unpaired claw bare, without denticle.
Palp 8.00 long (3.19, 1.48, 2.65, 0.68). Trichobothria on palpal tibia unmodified, present on proximal one-third part, on cymbium divided into unmodified and clavate forms, the former sparsely distributed at distal end of trichobothrial area, while the latter occupies majority of trichobothrial area; count of trichobothria: Tibia 3 / 3 d, cymbium 3 / 4 unmodified and 8 / 9 clavate. Tibia slender, moderately uniform in thickness (Fig. 2 View Figure 2 E and F), with one lyriform organ on ventro-prolateral side of sub-distal part and two adjacent lyriform organs on dorsal side of distal part; tibia lacks spines or spinules. Palpal organ: Tegulum oval (Fig. 2 View Figure 2 G and H); boundary of tegulum and distal haematodocha visible in retrolateral view of palpal bulb, not reaching base of embolus; embolus long, approximately 1.3 times the width of tegulum, with one distally elevated embolic keel extending from retrolateral side of sub-basal part of embolus to dorsal side of sub-distal part; edge of distal elevation of embolic keel slightly serrulate (Fig. 3 View Figure 3 A – C); apex of embolus thin, gradually tapering to small and sharp tip.
Female ( Paratype, MHBU-ARA- 10000047). Colouration in ethanol (Fig. 2 View Figure 2 B; for colouration of living female, see Fig. 1 View Figure 1 E). Carapace like male, but slightly darker, eye mound and fovea dark; in region near coxa III, outer edge of carapace darkening in colour, appearing burnt red; chelicerae reddish-brown, obviously darker than other body parts. Colour between palp and each leg without significant difference, overall similar in colour to carapace, with coxa III and trochanter III slightly darker. Opisthosoma: Dorsal side reddish-grey, with dense and small irregular pale spots; area around cardiac muscle spot obviously pale. Ventral side of whole body generally brighter than dorsal side (Fig. 2 View Figure 2 D); colour difference between sigilla and rest of sternum unconspicuous.
Total length 12.95. Carapace 5.13 long, 4.02 wide; opisthosoma 8.93 long, 5.26 wide. Eye group 0.67 long, 0.41 wide anteriorly, 0.66 wide posteriorly; MOA 0.51 long, front width 0.25, back width 0.41. Eye diameters and interdistance: AME 0.13, ALE 0.32, PME 0.24, PLE 0.31, AME – AME 0.12, AME – ALE 0.07, ALE – PLE 0.10, PME – PME 0.25, PME – PLE 0.04. MOA 0.51 long, front width 0.25, back width 0.41. Palpal coxa 2.07 long, 1.17 wide, bearing 20 / 18 cuspules and 0 / 1 basally thickened bristle on prolateral-proximal corner. Sternum 3.50 long, 3.17 wide. Labium 1.07 long, 0.90 wide, with two spinules, without cuspule. Chelicerae without stridulatory ridges; rastellum of left and right chelicerae carries 10 and nine stout spines, respectively; chelicerae groove with 5 / 8 and 7 / 7 teeth of different sizes on promargin and retromargin, respectively.
Leg formula 4123; measurements: I 9.11 (3.46, 1.77, 2.05, 1.05, 0.78), II 8.04 (3.03, 1.57, 1.58, 1.06, 0.80), III 6.22 (1.73, 0.97, 1.01, 1.38, 1.13), IV 11.38 (3.47, 1.93, 2.57, 1.99, 1.42). Spines of legs I – II primarily distributed on p, pd, r and rv of tibia, as well as p, pv, r and rv of metatarsus and tarsus; most spine tips weakly curved downwards, forming slight hook-shape; some spines on rv longer and not curved at tip. Trichobothria of legs present on proximal one-third part of tibiae I – III, proximal one-fourth part of tibia IV, distal half of metatarsi I – IV and proximal two-thirds of all tarsi; trichobothria on tibiae I – IV and metatarsi I – IV unmodified; trichobothria on tarsi divided into unmodified and clavate forms, with latter only present in proximal half of tarsus. Count of trichobothria on legs: I, tibia 5 / 5 pd and 5 / 5 rd, metatarsus 10 / 10, tarsus 15 / 12 unmodified and 11 / 7 clavate; II, tibia 5 / 5 pd and 5 / 4 rd, metatarsus 11 / 9, tarsus 11 / 12 unmodified and 6 / 7 clavate; III, tibia 4 / 4 pd and 4 / 4 rd, metatarsus 10 / 12, tarsus 15 / 11 unmodified and 1 / 3 clavate; IV, tibia 6 / 5 pd and 5 / 5 rd, metatarsus 8 / 8, tarsus 12 / 9 unmodified and? / 3 clavate. Coxae I – III bear band of spinules on ventro-posterior area. Tarsal claws: all paired claws with one tooth (Fig. 3 View Figure 3 G); unpaired claw bare, without denticle. Palp 8.86 long (3.49, 1.50, 2.08, 1.79), spines on palp distributed on p, pv, r and rv of tibia and tarsus; palpal tarsal claw with one basal tooth.
Vulva (Fig. 2 View Figure 2 I and Fig. 3 View Figure 3 D). Two separate sperm receptacles connected to wide and short atrium via slightly tapered stalk; sperm receptacles slightly outwardly inclined. Dense tan glandular pores present on distal half of stalk and throughout entire sperm receptacle. Glandular pores also present on basal half of stalk, atrium, as well as sparsely on the uterus externus, which is nearly transparent in colour.
Diagnosis
The male of new species morphologically resembles those of the adjacent mainland (Guandong) species Latouchia rufa Zhang & Wang, 2021 in the distinct distal elevation of the dorsal keel of the embolus (dK), forming a lamellar structure; however, it can be distinguished from L. rufa as here the dK extends across the proximal two-thirds of the embolus and the length of embolus is approximately 1.3 times the width of bulb (Fig. 2 View Figure 2 G – H); whereas in L. rufa , the dK extends almost to the tip of embolus, the length of embolus is almost equal to the width of bulb ( Zhang and Wang (2021): fig. 2 B). The female is similar to that of the rather geographically distant Vietnamese species L. stridulans Decae, 2019 in overall shape of vulva; however, it can be distinguished by the widest part of the stalk being at the base (Fig. 2 View Figure 2 I and Fig. 3 View Figure 3 D), whereas in L. stridulans , the widest part of the stalk is in the median part (see Decae et al. (2019): fig. 18). In addition, female also differs from those aspects of L. stridulans in the following: the chelicerae lack retrolateral stridulatory ridges and has a band of spinules on the ventro-posterior angle of coxae I to III (also present in the male, Fig. 2 View Figure 2 C – D and Fig. 3 View Figure 3 F), whereas in L. stridulans , the retrolateral side of the chelicerae has stridulatory ridges and there is no band of spinules at the posterior angle of any coxa. This species also can be distinguished from geographically close L. wenruni , L. yuanjingae and L. yejiei by whether the band of spinules is present at the posterior angle of coxa I to III.
Etymology
The specific epithet is Latin, meaning “ limestone-dweller ”; noun in apposition.
Distribution
Known only from the type locality of Hainan, China (Fig. 17 View Figure 17 ).
Biology
This newly discovered species constructs burrows in the crevices amongst rocks in the limestone cave of the type locality (Fig. 1 View Figure 1 A – B). All trapdoors were observed to be covered by small stone grains and some individuals exhibited the presence of small twigs and decomposed leaf fragments on the rim of the burrow entrance (Fig. 1 View Figure 1 F – K).
DNA barcode
AATCATAAAGATATTGGAACTTTATATATAGTGTTAGGGGTATGGTCCGCTATATTGGGTACAGGGATAAGAGTAATAATTCGGATGGAATTAGGACAGGTTGGTAGATTGATTGGAGATGATCATTTGTATAATGTTATTGTTACTGCTCACGCTCTTGTGATGATTTTTTTTATAGTGATGCCTATTATGATTGGGGGATTTGGAAATTGGCTATTGCCTTTGATATTGGGGAGTCCGGATATAGCTTTTCCACGTATGAATAATTTGAGTTTTTGATTATTGCCTCCTTCATTGATGATGTTTTTGATTTCTTCTTTAATTGATACGGGGGTTGGAGCGGGATGGACTATTTATCCTCCTTTGTCTTCTTGTTTGGGGCATAGAGGTGGGGGGATAGATTTTGTTATTTTTTCATTGCATCTAGCAGGGGCTTCTTCAATTATGGGAGCGGTGAATTTTATTTCTACTGTTATGAACATACGTCCTCAGGGAATGAAAATAGAACGGGTTCCTTTGTTTGTGTGATCTGTGTTAATTACGACTATTTTATTATTGTTGTCTTTACCAGTATTGGCGGGGGCAATTACGATATTATTAACTGATCGAAATTTTAATACCTCGTTTTTTGATCCGGCTGGGGGGGGGGATCCGGTGTTGTTTCAACATTTATTTTGATTTTTTGGTCACCC (GenBank accession number: PQ 585635).
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
