Leurus sondrawardae Zuñiga & Valerio, 2024
|
publication ID |
https://doi.org/10.11646/zootaxa.5529.3.5 |
|
publication LSID |
lsid:zoobank.org:pub:09787995-E3D5-4FB7-AB9F-AFB46371B02B |
|
DOI |
https://doi.org/10.5281/zenodo.14022827 |
|
persistent identifier |
https://treatment.plazi.org/id/572E8790-0F0E-A70A-95FE-53741523FE53 |
|
treatment provided by |
Plazi |
|
scientific name |
Leurus sondrawardae Zuñiga & Valerio |
| status |
sp. nov. |
Leurus sondrawardae Zuñiga & Valerio , sp. nov.
( Fig. 11 View FIGURES 10–13 )
Diagnostic description. Female. Fore wing length, 5.2−5.6 mm ( holotype 5.2 mm). Malar space 0.8−1.1 × basal mandibular width; antenna with 23–24 flagellomeres, most flagellomeres quadrate, except for the first 2 and the last 2–3. Coloration. Antennal scape brown, pedicel brown, flagellum brownish; tegula predominantly black, light yellow anteriorly; metasoma black, with metallic blue iridescence or completely black. Trochanters pale to light brown; fore femora pale to light orange, hind femora entirely black; fore tibia pale yellow to brownish, mid and hind tibiae entirely black; fore tarsus pale yellow, mid tarsus pale yellow with last 1–2 segments orangish to light brown, hind tarsus pale with all dark apices dark.
Male: Unknown.
Material. Holotype. ♀. Deposited at EMUS. 1. DHJPAR0036739 . 2. Caterpillar Voucher: D. H. Janzen & W. Hallwachs, DB: http://Janzen.sas.upenn.edu, Area de Conservation Guanacaste , Costa Rica, 09-SRNP-42662. Database information: Costa Rica, ACG, Alajuela Prov., Sector Rincon Rain Forest , Quebrada Escondida , 10.89928, -85.27486, 420m (Anabelle Cordoba), Piletosoma thialis ( Crambidae ) caterpillar feeding on Doliocarpus multiflorus ( Dilleniaceae ) coll. 22.ix.2009, wasp eclosed 19.x.2009. GoogleMaps Paratypes. 2 ♀, ( EMUS, MNCR). COSTA RICA, ACG database codes: 02-SRNP-720715, DHJPAR0014016 ( ♀); 09-SRNP-42108, DHJPAR0036732 ( ♀).
Barcode. DNA barcode of female holotype DHJPAR0036739 (636 bp):
GGCCCTTTACTTTATTTTTGGCATTTGAGCTGGAATAATTGGAACCTCTCTAAGAATCATTATTCG AATAGAATTAGGAACCCCCGGCTCTTTAATTAATAATGACCAAATTTATAATTCTATCGTCACTATAC ATGCCTTTATCATAATTTTTTTTATAGTAATACCAATTATGATTGGGGGATTTGGTAATTGACTTGCTCCATT AATATTGGGGGCCCCAGATATAGCTTTCCCACGAATAAATAATATAAGATTTTGATTATTACCCCCATC ATTATTCTTATTAATTTCAGGAAGAATCCTAAATCAAGGGGCCGGAACTGGATGAACAGTATATCCACCTTTATC ATCTAATACTAATCATGAAGGATTATCAGTTGATTTAAGAATTTTTTCCCTTCATTTAGCAGGCATGTCCTCAATT ATAGGGGCAATCAACTTCATTACAACTATTTTTAATATAAAAATTAAATTATTAACTTTAGACCAACTTTCATT ATTTATTTGATCTATTAAAATTACTACTATTCTTCTACTACTTGCAGTCCCTGTTTTAGCAGGGGCAATCACT ATATTATTAACAGATCGTAACTTAAA TACCTCTTTTTTTGACCCAAGAGGGGGCGGAGACCC
Etymology: This species is named in honor of the late Sondra Ward, formerly of the Natural History Museum in London, for her invaluable assistance in the study of Ichneumonidae .
Comments. We were unable to distinguish L. sondrawardae morphologically from L. hugokonsi . Both species have metallic blue on the metasoma, the scape dark colored (at least dorsally) and without white on the apex, the tegula entirely or at least 90% black, hind tarsomeres 1–2 with dark apices, and hind tibia with white base not extending more than 3.0 × length of tibia. However, L. sondrawardae has a very distinctive and different DNA barcode, and it parasitizes a very different species of caterpillar feeding on a different family of host plants.
Hosts. Leurus sondrawardae has been reared from Piletosoma thialis Dyar ( Crambidae ) feeding on the rainforest liana, Doliocarpus multiflorus ( Dilleniaceae ). No other species of the L. caeruliventris complex in ACG utilizes this caterpillar genus or this host plant family.
| MNCR |
Museo Nacional de Costa Rica |
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
|
Kingdom |
|
|
Phylum |
|
|
Class |
|
|
Order |
|
|
Family |
|
|
Genus |
