Friesea najtae, D’Haese & Stevens & Weiner, 2017

D’Haese, Cyrille A., Stevens, Mark I. & Weiner, Wanda M., 2017, Friesea najtae n. sp. (Collembola, Neanuridae, Frieseinae) from southern Western Australia, Zoosystema 39 (1), pp. 21-29 : 22-28

publication ID	https://doi.org/ 10.5252/z2017n1a3
publication LSID	urn:lsid:zoobank.org:pub:2DE4E993-0837-4399-B075-73CC1AE867A8
persistent identifier	https://treatment.plazi.org/id/5306878E-CC17-FFF2-DE73-F911FD9A6996
treatment provided by	Felipe
scientific name	Friesea najtae
status	sp. nov.

Treatment

Friesea najtae n. sp.

( Figs 1-6 View FIG View FIG View FIG View FIG View FIG View FIG )

TYPE MATERIAL. — Holotype. South-Western Australia (WA), D’Entrecasteaux National Park, next to Windy Harbour road, 20 km South of Northcliffe and 2 km from the coast, 8 m a.s.l.; on the surface of swamps ( Fig. 1A, B View FIG ), sample au021a ( Fig. 1B View FIG ), 17.XI.2013, 34.82468°S, 116.06025°E, D’Haese leg, ♀, slide WAM – E 96053 View Materials (MNHN-EA013918). GoogleMaps

Paratypes. Same data as the holotype, 3 ♂ and 1 ♀, slides WAM - E 96054 View Materials -55 (MNHN-EA013921-22 and sample au047 ( Fig. 1A View FIG ), 25.XI. 2013, 34.82462°S, 116.06084°E, D’Haese leg, ♂ and ♀, slides WAM - E 96056 View Materials -63, SAMA 01-001327-28, ISEA EA013923- 26 and MNHN-EA013927-30.

MATERIAL EXAMINED. — Southern Western Australia (WA), D’Entrecasteaux National Park, next to Windy Harbour Road, 20 km South of Northcliffe and 2 km from the coast, 8 m a.s.l.; on the surface of swamps ( Fig. 1A, B View FIG ):

– sample au021a ( Fig. 1B View FIG ), 17.XI.2013, 34.82468°S, 116.06025°E, c. 30 specimens, D’Haese leg; slides EA013918-22 and MEB plate EA030026 with 4 specimens ;

– sample au47 ( Fig. 1A View FIG ), 25.XI. 2013, 34.82462°S, 116.06084°E, c. 40 specimens, D’Haese leg; slides EA013923-27 .

DIAGNOSIS. — Friesea najtae n. sp. is characterized by a dark blue colour ( Fig. 2 View FIG ), large size for the genus (up to 1.7 mm), 8 +8 eyes ( Fig. 4B View FIG ), trilobated apical vesicle ( Fig. 4A View FIG ), 6 strong anal spines, symmetrical along their axis, without papillae on abdominal VI ( Fig. 6A, B, D View FIG ), no capitate tenent hairs on tibiotarsi or Abd. V-VI and a fully developed furcula with a large mucro slightly fused to the dens (stage 1-2 according to Cassagnau 1958: figs 3A, 6F).

DISTRIBUTION. — To date, Friesea najtae n. sp. is only known from southern Western Australia from the two collecting sites (55 m apart from each other) au021a ( Fig. 1B View FIG ) and au047 ( Fig. 1A View FIG ).

HABITAT. — These animals were found walking on the surface of the water in swamps ( Fig. 1A, B View FIG ). It is worth noticing that they were not found in Berlese-extracted samples of litter and soil collected on the side of the water. However, they could be from the other side of the pond and blown by the wind (surface water current). They are likely to inhabit the riparian zone, similar to Chionobora amila Greenslade & Potapov, 2015 for example ( Stevens & D’Haese 2016).

ETYMOLOGY. — Judith Najt was C. D’Haese’s PhD advisor and friend, and a very long term colleague and dear friend of Wanda Weiner. The new species is named in her honour.

DESCRIPTION

General habitus

Large animal for the genus, habitus with strong head with diverging antennae shorter than head length and a large abdo- men in midline (Abd. III-IV), ending by a pointed Abd. VI ( Figs 2 View FIG , 3 View FIG ). Body length: 1.0- 1.7mm. Body colour dark blue, almost black ( Fig. 2 View FIG ), slightly lighter on the ventral side with inner sides of ventral tube and furcula tip almost white. Dorsal clothing strong, with long and pointed ordinary chaetae as well as shorter chaetae, slightly crenulated (macro-, meso- and microchaetae; Fig. 3A, B View FIG ).

Head

Antennae about ª/5 of head length. Ant. I with 7 chaetae, Ant. II with 13 chaetae. Ant. III and IV dorsally fused, ventrally weakly separated. Sensory organ of Ant. III consisting of 2 small subcylindrical internal microsensilla hidden by a fold, two subcylindrical guard sensilla, ventral microsensillum. Ant. IV truncated ventro-internally, sensilla difficult to distinguish from ordinary chaetae ( Figs 3A View FIG ; 5D View FIG ); apical vesicle trilobated ( Figs 4A View FIG ; 5D View FIG ).

Ocular area with 3 chaetae (oc1-3) and 8+ 8 ocelli, all subequal; postantennal organ absent ( Figs 3A View FIG ; 4B View FIG ; 5B View FIG ). Chaetotaxy of labrum: 2/5,3,4. Labium with papillated chaeta L.

Head of maxillae typical for the genus ( Fig. 5E View FIG ), mandibles as in Fig. 5F View FIG .

Chaetotaxy Dorsal chaetotaxy as in Fig. 5 View FIG A-C. Dorsal chaetae of various length, very slightly crenulated with s -chaetae meso-chaetae. S -chaetae formula per half tergum: 022/11111. Head with chaetae a0, d0 and three chaetae oc. Thoracic tergum I with 5 + 5. Dorsal chaetotaxy (Thoracic terga II to Abd. VI) with some asymmetries and slight plurichaetosis, see Figure 5A, B View FIG , making chaetae designation difficult. Thoracic sterna without chaetae, Abd. II and Abd. III sterna with 12+ 12 14+ 14 chaetae respectively. Ventral tube with 11+ 11 chaetae ( Fig. 4C View FIG ).

Body with several peudopores on various positions ( Fig. 4D View FIG ).

Six strong anal spines without papillae ( Figs5C View FIG ; 6 View FIG A-C), sometimes more due to plurichaetosis and asymmetries ( Fig. 6D View FIG ). Thoracic sterna without chaetae.

Legs

Tibiotarsi I, II and III with 18, 18 and 16 chaetae respectively ( Fig. 5G View FIG ). No clavate tenent hairs. Claw with a very small median tooth ( Figs 5G View FIG ; 6E View FIG ).

Furcula

Furcula fully developed, dens with 3 chaetae each, mucro large even if slightly fused with the dens (stage 1 - stage 2 according to Cassagnau 1958) ( Fig. 6F View FIG ). Tenaculum present with 2+ 2 teeth.

DNA barcode

A 658 base-pair (bp) fragment of the mitochondrial (mt) DNA cytochrome c oxidase I (COI) gene (DNA barcode) was amplified and sequenced for specimen EA013922 (see paratype information above) and deposited in BOLD database under accession number ADF3744. The base composition of the DNA barcode sequence is 26.4% A, 33.1% T, 22.2% C and 18.2% G (A +T = 59.6%):

5’ – ATCTATATATTTTCTTCTAGGTACATGAGCTGCTTT- TACCGGGACATCTCTAAGTATCTTAATTCGATTAGAACTAG- GTCAGGCAGGATCGTTTATCGGAAGAGATCAAACATATAATG- TAATTGTAACGGCCCATGCTTTTATTATGATTTTCTTCATAGT- TATACCTATAATAATTGGGGGGTTTGGAAACTGACTCGTTC- CATTAATAATTGGAGCCCCTGATATAGCATTCCCCCGGA- TAAATAATATAAGATTCTGGCTTCTTCCACCGTCTCTAACC- CTTTTATTAGCAGGTAGAGTAGTAGAAAGAGGGGCAGGAACGG- GATGAACAGTTTATCCCCCTCTTTCATCTAATCTAGCTCACGC- CGGTAGCTCAGTGGACTTATCTATTTTTAGTCTACACCTCGC- CGGGGCTTCTTCTATCCTAGGAGCAGTTAATTTTATTACCACTAT- CATTAATATACGGTCAGAAGGGATGTCCTGAGACCAAATACCC- CTTTTTGTTTGATCAGTTATATTAACGGCCATTCTTCTACTTC- TATCTCTCCCAGTGCTGGCAGGTGCCATCACTATACTTCTAACT- GATCGTAACCTAAATACCTCTTTTTTCGACCCAGCCGGAGGAGGG- GACCCAATTTTATACCAACACTTATTT – 3’.