Hesperia pahaska tehaska Grishin, 2025
|
publication ID |
https://doi.org/10.5281/zenodo.16642576 |
|
DOI |
https://doi.org/10.5281/zenodo.16805878 |
|
persistent identifier |
https://treatment.plazi.org/id/4D7E87DA-4BDE-72AB-FE3A-FB1DABEAF90A |
|
treatment provided by |
Felipe |
|
scientific name |
Hesperia pahaska tehaska Grishin |
| status |
new subspecies |
Hesperia pahaska tehaska Grishin , new subspecies
http://zoobank.org/ B60AB082-28E4-4B12-AA0F-FB84DBD5A043 ( Figs. 126 View Fig part, 127, 128 part)
Definition and diagnosis. Genomic analysis reveals that southern populations currently identified as Hesperia pahaska williamsi Lindsey, 1940 ( type locality in USA: Arizona, Pima Co.) form a clade that is distinct from it and are genetically differentiated from other populations at the subspecies level ( Fig. 126 View Fig ); e.g., their COI barcodes differ by 0.8% (5 bp) from the genetically closest subspecies H. p. williamsi. Therefore, these populations represent a new subspecies. This new subspecies keys to “ Hesperia columbia pahaska ” (M.10.5.(b)) in Evans (1955) and statistically differs from other subspecies of H. pahaska Leussler, 1938 ( type locality in USA: Nebraska, Sioux Co.) by a combination of the following characters: typically larger size, larger white spots on the ventral side of wings than in H. pahaska williamsi , ventrally darker and greener than H. pahaska pahaska , and typically with longer, better-defined subapical and submarginal spots on the dorsal forewing. Due to extensive individual variation and possibly cryptic nature of this subspecies, most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly3598.2.1:C783T, aly3598. 2.1:G610A, aly383.17.7:C1131A, aly383.17.7:A1176T, aly479.9.3:G207A; and COI barcode: T19C, A373G, T386C, A562G, T613C.
Barcode sequence of the holotype. Sample NVG-23049B09, GenBank PV550058, 658 base pairs: AACTTTATATTTTATTTTCGGTATTTGAGCTGGTATATTAGGAACTTCATTAAGTTTATTAATTCGAACAGAATTAGGTAATCCTGGATCTTTAATTGGAGATGACCAAATTTATAATACT ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATGCCAATTATAATTGGAGGATTTGGAAATTGATTAGTACCTTTAATATTAGGAGCTCCTGACATAGCTTTTCCACGTA TAAATAATATAAGATTTTGAATATTACCACCTTCATTAACATTATTAATTTCAAGAAGAATTGTAGAAAATGGTGCTGGAACAGGATGAACTGTTTATCCTCCTTTATCCTCTAATATTGC TCACCAAGGGTCTTCTGTTGATCTAGCAATTTTTTCTCTTCACTTAGCTGGAATTTCATCTATTTTAGGAGCTATTAATTTTATTACAACAATTATTAACATACGAATTAAAAACTTATCT TTTGATCAAATACCTTTATTTGTTTGATCTGTAGGAATTACAGCATTATTATTACTTTTATCTTTACCTGTATTAGCGGGAGCTATTACTATACTACTTACTGACCGAAATTTAAATACTT CTTTTTTCGATCCAGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT
Type material. Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity Collection, Gainesville, FL, USA (MGCL), illustrated in Fig. 127 View Fig , bears the following six printed (text in italics handwritten) rectangular labels, five white: [ TEXAS: | JEFF DAVIS COUNTY | Davis Mtns. | Fisher Hill 6141'], [ William W. & | Nadine M. McGuire | coll. 28-VIII -7 7], [Collection of | William W. McGuire], [FSCA | Florida State Collection | of Arthropods], [DNA sample ID: | NVG-23049B09 | c/o Nick V. Grishin], and one red [HOLOTYPE ♂ | Hesperia pahaska | tehaska Grishin]. Paratypes: 7♂♂ and 5♀♀ in MGCL unless stated otherwise: USA, Texas: 1♂ NVG-23051B03 Culberson Co., 12 mi S and 10 mi E of Van Horn, 11-May-1973, J. Harry leg.; Jeff Davis Co., Davis Mnts .: 1♂ NVG-10967 SH118 S of McDonald Observatory , GPS 30.6597, −104.0232, 9-Apr-2018, N. V. Grishin leg. [ UTSW], GoogleMaps 1♀ NVG-23049B10, 29 mi W of Fort Davis, 28-Aug-1977, W. W. & N. M. McGuire leg., and 1♀ NVG-11128 SH118 nr. Caldwell Ranch , GPS 30.736725, −104.139271, 18-May-2018, N. V. Grishin & J. Zhang leg. [ UTSW]; GoogleMaps Presidio Co.: 1♂ NVG-23049B04 3 mi N of Shafter, 29-May-1973, W. W. & N. M. McGuire and 1♀ NVG-23049B05 Shafter , 9-Jun-1961, H. A. Freeman leg.; Brewster Co.: 1♂ NVG-23051A01 10 mi N of Persimmon Gap, 26-May-2008, C. Bordelon & E. Knudson leg., 1♂ NVG-23051B01 USH90 , ca 35 mi W of Sanderson, 8-Jun-1974, W. W. McGuire leg., and 1♀ NVG-23051B02 USH90, 14 mi E of Marathon, coll. 26-Jul-1977, ex ovum, W. W. & N. M. McGuire leg.; Pecos Co., USH90 , 20 mi W of Sanderson, W. W. McGuire leg.: 1♂ NVG-23049B07 20-May-1973 and 1♀ NVG-23049B08 9-Jun-1974; and 1♂ NVG-23051C10 McCulloch Co ., Heart of Texas Roadside, 24-Apr-1980, D. Bauer leg .
Type locality. USA: Texas, Jeff Davis Co., Davis Mts., Fisher Hill GoogleMaps , elevation 6141’, approx. GPS 30.6972, −104.0967.
Etymology. The name is formed from the type locality and is treated as a feminine noun in apposition.
Distribution. Central to West Texas ( USA).
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
|
Kingdom |
|
|
Phylum |
|
|
Class |
|
|
Order |
|
|
Family |
|
|
SubFamily |
Hesperiinae |
|
Tribe |
Hesperiini |
|
Genus |
