Emesis ( Tenedia ) guaya Grishin, 2025
|
publication ID |
https://doi.org/10.5281/zenodo.16642576 |
|
DOI |
https://doi.org/10.5281/zenodo.16802308 |
|
persistent identifier |
https://treatment.plazi.org/id/4D7E87DA-4B69-721F-FE56-FEC0AD48FF3C |
|
treatment provided by |
Felipe |
|
scientific name |
Emesis ( Tenedia ) guaya Grishin |
| status |
new species |
Emesis ( Tenedia) guaya Grishin , new species
http://zoobank.org/ DC681E0D-9AFE-4559-9B1E-B9725FD12AC0
( Figs. 16 View Fig part, 18)
Definition and diagnosis. A specimen from Uruguay is sister to Emesis ( Tenedia) tinia sp. n. ( type locality in Argentina) described above, but is genetically differentiated from it at the species level ( Fig. 16 View Fig ); e.g., their COI barcodes differ by 2.1% (14 bp), which in the presence of phenotypic differences suggests that it belongs to a new species. This new species is most similar to E. tinia sp. n. in is smaller size and wing pattern consisting of darker wavy lines, spots, and dashes but differs from it by slightly broader wings, a weaker contrast between darker brown and paler brown areas on the dorsal side of the wings, a more prominent postdiscal dark-brown wavy line on the ventral forewing consisting of closer connected elements in every cell, and a not as strongly developed darker discal band basad of this wavy line as in E. tinia sp. n. Due to the cryptic nature of this species and unexplored individual variation, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: cne977.2.4:A87G, cne977.2.4:T99C, cne2582.13.11:A75G, cne5556.4.1:C600T, cne5556.4.1:G606A; and COI barcode: A31C, A40G, A202C, T478A, T520C, T547C.
Barcode sequence of the holotype. Sample NVG-24032D02, GenBank PV549984, 658 base pairs: AACATTATATTTTATTTTTGGAATTTGAGCCGGAATAGTGGGAACATCTTTAAGTTTATTAATTCGAATAGAATTAGGAACTTCAGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATGGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTCCCATTAATATTAGGAGCTCCAGACATAGCTTTCCCACGAA TAAATAATATAAGATTTTGATTATTACCCCCCTCATTAATTTTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCTGGAACAGGATGAACAGTGTACCCCCCACTTTCATCTAATATCGC CCATGGAGGATCATCAGTAGATTTAGCTATTTTTTCTTTACATTTAGCTGGTATTTCTTCTATTTTAGGAGCAATTAATTTTATCACCACTATTATCAATATACGAATTAATAAATTATCA TTTGATCAAATACCTCTTTTTGTCTGATCTGTAGGCATTACAGCACTTTTACTTTTATTATCCTTACCTGTTTTAGCGGGAGCTATTACTATATTATTAACTGATCGTAATTTAAACACAT CATTTTTTGATCCTGCAGGAGGAGGTGATCCAATTTTATATCAACATTTATTT
Type material. Holotype: ♂ deposited in the Museum für Naturkunde, Berlin, Germany ( MFNB), illustrated in Fig. 18 View Fig , bears the following five rectangular labels (1 st handwritten, others printed), four white: [ Uruguay | Rschus.], [Coll. | Staudinger], [DNA sample ID: | NVG-24032D02 | c/o Nick V. Grishin], [{QR Code} MfN URI | http://coll.mfn- | berlin.de/u/ | 0a0d27], and one red [HOLOTYPE ♂ | Emesis (Tenedia) | guaya Grishin].
Type locality. Uruguay.
Etymology. The name is given for the country with the type locality: [Uru] guay + a, and also refers to a prominently defined wire-like meandering discal dark line on the ventral forewing (in Spanish, guaya may mean cable or wire). The name is treated as a noun in apposition.
Distribution. Currently known only from the holotype collected in Uruguay.
| MFNB |
Museo Friulano di Storia Naturale |
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
|
Kingdom |
|
|
Phylum |
|
|
Class |
|
|
Order |
|
|
Family |
|
|
Genus |
