Phanus ecutinus Grishin, 2025

Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina & Grishin, Nick V., 2025, Advancing butterfly systematics through genomic analysis, The Taxonomic Report of the International Lepidoptera Survey 12 (5), pp. 1-201 : 33-34

publication ID

https://doi.org/10.5281/zenodo.16642576

DOI

https://doi.org/10.5281/zenodo.16806774

persistent identifier

https://treatment.plazi.org/id/4D7E87DA-4B5E-722A-FD91-FD37AC95F9E1

treatment provided by

Felipe

scientific name

Phanus ecutinus Grishin
status

new species

Phanus ecutinus Grishin , new species

http://zoobank.org/ 03E1BABC-DBC8-4A41-8438-2F0AEB2EA823

( Figs. 25 View Fig part, 26–27)

Definition and diagnosis. A female from Ecuador identified as Phanus ecitonorum Austin, 1993 ( type locality in Brazil: Rondônia) by G. T. Austin after the dissection of genitalia appears as sister in the nuclear genome tree to several closely related species including P. ecitonorum ( Fig. 25a View Fig ), differing from it by 4.3% (28 bp) in the COI barcode, and, therefore, represents a new species. This species keys to P. ecitonorum in the key for females in Austin (1993) but differs from it by a narrower brown crevice in the hyaline spot in the forewing discal cell; smaller than the third, two subapical spots near the costa; and a larger dark brown ground color area between the forewing discal and postdiscal spots (e.g., the basal edge of the spot in the M 3 -CuA 1 cell is more excavate). Female genitalia are heavily sclerotized, with broader (in ventral view) lamella antevaginalis and papillae anales; a concave near its posterior end ventral margin of the side lobe of lamella antevaginalis; a deeply notched in the middle lamella postvaginalis with arcshaped and more evenly curved posterior margin on both sides of the notch, which is U-shaped, rounded anteriad and wider posteriad; and a wider, longer, and stronger sclerotized antrum ( Fig. 27 View Fig ). Due to the cryptic nature of this species and unexplored individual variation, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly 1042.6.1: G360A, aly 1651.12.7:C153A, aly 1651.12.7:A168G, aly725.22.2:T45C, aly725.22.2:T54C, aly366.11.3: C489C (not T), aly366.11.3:A499A (not G), aly6841.72.2:T42T (not C), aly1931.14.4:T48T (not C), aly1139.62.12:T492T (not A); and COI barcode: A31C, C43T, T226C, T394C, T514C, T589C. Barcode sequence of the holotype. Sample NVG-24074D06, GenBank PV549987, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCCGGAATAGTAGGTACATCTTTAAGTTTATTAATTCGAACAGAATTAGGAACCCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATTGTTACTGCTCATGCATTTATTATAATTTTTTTTATAGTAATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTACCTTTAATATTGGGTGCCCCAGACATAGCTTTCCCTCGAA TAAATAATATAAGTTTTTGACTCCTCCCCCCATCATTAACTTTATTAATCTCAAGAAGAATTGTAGAAAATGGAGCCGGAACTGGATGAACAGTTTATCCCCCTCTTTCATCTAATATTGC TCACCAAGGTTCATCTGTCGATTTAGCAATCTTTTCCTTACACTTAGCTGGAATTTCATCTATTTTAGGTGCAATTAATTTTATTACTACAATTATTAATATACGTATTAGAAATTTATCT TTTGATCAAATACCCTTATTCATTTGAGCCGTTGGAATTACTGCTTTATTATTATTACTTTCTCTTCCTGTTTTAGCAGGAGCTATTACAATACTTTTAACTGACCGAAATTTAAATACAT CATTTTTTGATCCTGCTGGAGGAGGAGATCCAATTCTTTACCAACATTTATTT

Type material. Holotype: ♀ deposited in the McGuire Center for Lepidoptera and Biodiversity Collection, Gainesville, FL, USA ( MGCL), illustrated in Fig. 26 View Fig (genitalia Fig. 27 View Fig ), bears the following seven printed (text in italics handwritten) rectangular labels, six white: [ ECUADOR | Pichincha Province | Hotel Tinalandia | 12 km E Santa | Domingo de los | Colorados | 750–850 m | 13 May 1988 | leg G&A Austin], [ Phanus vitreus | (Stoll) | det GT Austin 199 1], [Genitalia Vial | GTA- 2247], [ Phanus ecitonorum | Austin | det. G. T. Austin | 1992], [G T Austin colln | MGCL Acc. | 2004-5], [DNA sample ID: | NVG- 24074D06 | c/o Nick V. Grishin], and one red [HOLOTYPE ♀ | Phanus ecutinus | Grishin].

Type locality. Ecuador: Pichincha, Santo Domingo de los Colorados , Tinalandia Lodge .

Etymology. The name is given for the type locality and is a fusion of Ecu [ador] + Tin [alandia] + us. The name is treated as a noun in apposition.

Distribution. Currently known only from the holotype collected west of the Andes in northern Ecuador.

Kingdom

Animalia

Phylum

Arthropoda

Class

Insecta

Order

Lepidoptera

Family

Hesperiidae

SubFamily

Eudaminae

Tribe

Entheini

Genus

Phanus

GBIF Dataset (for parent article) Darwin Core Archive (for parent article) CoL Data Package (for parent article) View in SIBiLS Plain XML RDF