Entheus colombeus Grishin, 2025
|
publication ID |
https://doi.org/10.5281/zenodo.16642576 |
|
DOI |
https://doi.org/10.5281/zenodo.16804120 |
|
persistent identifier |
https://treatment.plazi.org/id/4D7E87DA-4B52-7238-FE6B-F97FABEDFD3E |
|
treatment provided by |
Felipe |
|
scientific name |
Entheus colombeus Grishin |
| status |
new species |
Entheus colombeus Grishin , new species
http://zoobank.org/ CE830AFA-9AE0-4B04-A57B-7C81ECDAECBE ( Figs. 31 View Fig part, 37–38, 50 part, 51h)
Definition and diagnosis. Genomic analysis of Entheus Hübner, [1819] ( type species Papilio peleus Linnaeus, 1763 , which is a junior subjective synonym of Papilio priassus Linnaeus, 1758 ) reveals that a male from eastern Colombia does not group with any single known species with strong statistical support (65% with Entheus curvus Austin, 1997 in the nuclear genome tree of this group, Fig. 31a View Fig , and 87 View Fig % within the E. telemus subgroup in the Entheus species tree, Fig. 50a View Fig ) and is genetically differentiated from them at the species level in the nuclear genome ( Fig. 31a View Fig ). However, likely due to introgression, the COI barcode of this Colombian specimen is shared with Entheus priassus ( Linnaeus, 1758) ( type locality stated in Suriname) and Entheus curvus Austin, 1997 ( type locality in Peru: Loreto), although the overall mitochondrial genome differentiates them ( Fig. 31b View Fig ). Due to its genetic differentiation and phylogenetic position in the nuclear genome tree, this specimen represents a new species. This new species keys to “ Entheus priassus telemus ” (B.10.4(b)) in Evans (1952) and is phenotypically closer to Entheus latebrosus Austin, 1997 ( type locality Ecuador: Limoncocha, Río Napo), Entheus telemus Mabille, 1898 ( type locality in Brazil) and the next two new species described below, but differs from them by a combination of the following characters in males (female unknown): forewing orange spotting is intermediate in width and extent between Entheus telemus Mabille, 1898 ( type locality in Brazil) and E. priassus : color is yellower than in E. telemus , the subapical band is narrowly connected with the discal band at the anterior distal end of the discal cell leaving a brown triangle towards the costa, the spot between the bands is not engulfed by the posterior segment of the discal band (engulfed in E. telemus ) and the outer margin of the discal band is straight and aligned anterior and posterior of the middle spot; the hindwing is entirely dark brown on both sides; the hindtibial brush is orange and the tuft is brown, darker than in E. priassus but paler than in E. telemus . Due to the cryptic nature of this species and unexplored individual variation, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly669.15.1: C1056T, aly669.15.1:A1089C, aly4456.7.2:A78T, aly4456.7.2:G102T, aly727.9.9:G183A, aly3404.1.20: G159G (not A), aly3404.1.20:G162G (not A), aly3404.1.20:A169A (not T), aly 2835.2.15:C96C (not A), aly 2835.2.15:C102C (not T). This species cannot be confidently identified by the COI barcode (possibly due to introgression), while differing from related species in other regions of the mitochondrial genome ( Fig. 31b View Fig , 50c View Fig ).
Barcode sequence of the holotype. Sample NVG-15099C09, GenBank PV549994, 658 base pairs: AACTTTATATTTTATTTTCGGAATTTGAGCAGGAATAGTAGGAACTTCCTTAAGATTATTAATTCGAACTGAATTAGGAACTCCTGGATCATTAATTGGAGATGATCAAATTTATAATACT ATCGTTACTGCGCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGATTGGTACCTTTAATATTAGGAGCTCCTGACATAGCTTTTCCTCGAA TAAATAATATAAGTTTTTGACTCTTACCCCCATCATTAACATTATTAATTTCTAGAAGAATTGTTGAAAATGGAGCTGGAACAGGATGAACTGTTTACCCCCCTTTATCTGCTAATATTGC CCACCAAGGATCTTCTGTAGATTTAGCCATTTTTTCCCTTCATTTAGCTGGAATTTCATCAATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGTATTAGAAATTTATCA TTTGATCAAATACCTCTATTTGTTTGAGCAGTAGGTATTACTGCATTACTTTTATTATTATCTTTACCCGTATTAGCAGGTGCTATTACTATACTTTTAACAGATCGAAATTTAAATACAT CATTTTTTGATCCTGCAGGAGGAGGAGATCCTATTCTTTATCAACACTTATTT
Type material. Holotype: ♂ deposited in the Carnegie Museum of Natural History, Pittsburgh, PA, USA ( CMNH), illustrated in Figs. 37 View Fig and 51h View Fig (genitalia Fig. 38 View Fig ), bears the following six printed (text in italics handwritten) rectangular labels, five white: [East Colombia], [734], [Genitalia Slide | No. 483], [Exch. A.N.S.P. | C.M.Acc.20359], [DNA sample ID: | NVG-15099C09 | c/o Nick V. Grishin], and one red [HOLOTYPE ♂ | Entheus | colombeus Grishin].
Type locality. Eastern Colombia.
Etymology. The name is formed from the type locality and is treated as a masculine noun in apposition.
Distribution. Currently known only from the holotype collected in eastern Colombia.
Comment. We have not attempted to remount the old genitalia slide No. 438 (currently in the CMNH cabinet with genitalia slides, mostly prepared by R. Williams) and illustrate genitalia here in their original condition, as mounted with dorsal tips of both harpes folded over, likely during the slide preparation ( Fig. 38 View Fig ). The harpes are three-dimensional and smoothly curve inward (towards each other), creating a challenge with mounting on a flattened slide.
| CMNH |
The Cleveland Museum of Natural History |
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
|
Kingdom |
|
|
Phylum |
|
|
Class |
|
|
Order |
|
|
Family |
|
|
SubFamily |
Eudaminae |
|
Tribe |
Entheini |
|
Genus |
