Entheus venezuelius Grishin, 2025
|
publication ID |
https://doi.org/10.5281/zenodo.16642576 |
|
DOI |
https://doi.org/10.5281/zenodo.16804160 |
|
persistent identifier |
https://treatment.plazi.org/id/4D7E87DA-4B45-7233-FE72-FE86A8E7FC7F |
|
treatment provided by |
Felipe |
|
scientific name |
Entheus venezuelius Grishin |
| status |
new species |
Entheus venezuelius Grishin , new species
http://zoobank.org/ 3DE8615E-5BAB-43AB-8EDD-DEA0B421FCF3 ( Figs. 36p–z View Fig , 44 View Fig part, 47, 50 part, 51o–p)
Definition and diagnosis. Genomic analysis reveals that specimens from Venezuela that are traditionally identified as Entheus aequatorius Mabille & Boullet, 1919 , stat. rest. ( type locality given in the original description as “ Bolivia ” likely by mistake, and may be in Ecuador: Bolivar), are indeed its sister, but are genetically differentiated from it at the species level ( Figs. 44 View Fig , 50 View Fig ); e.g., their COI barcodes differ by 1.2% (8 bp), thus representing a new species. This new species keys to “ Entheus matho aequatorius ”(B.10.5(c)) in Evans (1952) who included it into this taxon, but noted that Venezuelan specimens were “smaller, ♀ upf with spot mid costa,” and differs from its relatives by a combination of the following characters: smaller in size; males with more extensive rusty overscaling on both sides of the wings, the color of the forewing bands and spots is yellower, less orange; the tibial tuft is tawny, paler than in E. aequatorius ; the pale area of the anal fold is smaller and yellower; females with a white area on the hindwing more restricted towards the anal margin and a pale spot by mid-costa on the forewing aligned with the discal cell white spot, not offset basad. Due to the cryptic nature of this species and unexplored individual variation, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly2653.1.9:C117G, aly2130.3.5:T153C, aly997.1.7:T42A, aly671.50.4: C147 T, aly 2874.5.3:G177A; and COI barcode: T49 C, T115 C, T226 C, A373G, G506G, T646 C.
Barcode sequence of the holotype. Sample NVG-15026F10, GenBank PV550001, 658 base pairs: AACTTTATATTTTATTTTCGGAATCTGAGCAGGAATAGTAGGTACTTCCCTAAGATTATTAATTCGAACTGAATTAGGAACTCCTGGATCATTAATTGGAGATGATCAAATTTACAATACT ATTGTTACTGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGTTTTGGAAATTGATTAGTACCTTTAATATTAGGAGCCCCTGACATAGCTTTTCCTCGAA TAAATAATATAAGTTTTTGACTTCTACCCCCATCATTAACATTATTAATTTCTAGAAGAATTGTTGAAAATGGAGCTGGAACAGGATGAACAGTTTACCCCCCTTTATCTGCTAACATTGC CCACCAAGGGTCTTCAGTAGATTTAGCTATTTTTTCCCTTCATTTAGCTGGTATTTCATCAATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAGAAATTTATCA TTTGATCAAATACCTTTATTTGTTTGAGCAGTAGGTATTACTGCACTACTTTTATTATTATCTTTACCTGTATTAGCAGGTGCTATTACTATACTTTTAACAGATCGAAATTTAAATACAT CATTTTTTGATCCTGCGGGAGGAGGAGATCCAATTCTTTACCAACATTTATTT
Type material. Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity Collection, Gainesville, FL, USA ( MGCL), illustrated in Figs. 47a View Fig and 51o View Fig (genitalia Fig. 36p–w View Fig ), bears the following five printed (text in italics handwritten) rectangular labels, four white: [ Rancho Grande . 1200 m. | Parque Nac. Henri Pittier | Edo. Aragua , Venezuela | T.E. Pliske VI-29-75], [Genit. Prep. | SRS- 1278], [Allyn Museum | Acc. 19 80-29], [DNA sample ID: | NVG-15026F10 | c/o Nick V. Grishin], and one red [HOLOTYPE ♂ | Entheus | venezuelius Grishin]. Paratypes: 2♂♂ and 2♀♀ from Venezuela, Argua: 1♀ NVG-15026F11 the same data as the holotype, genitalia SRS-1279 ( Figs. 47b View Fig , 51p View Fig ) and 1♀ NVG-14062C01 Eancho Grande , 1100 m, 19-Jun-1985, S. S. Nicolay leg. [ USNM]; 1♂ NVG-14113A05 Yuracay, Hacienda Tropicale ca. 10 km S of San Felipe, 100–400 m, GPS 10.2917, −68.6667, 26-Jan-23-Feb-1993, Kareofelas & Witham leg. [ LACM]; and GoogleMaps 1♂ NVG-15032C11 (leg DNA extraction, sequenced), NVG-24028H11 (abdomen DNA extraction and dissection) Carabobo, Puerto Cabello, no date [around 1900], Hahnel leg., genitalia vial NVG241114 -17 ( Fig. 36x–z View Fig ) [ MFNB] .
Type locality. Venezuela: Aragua, Henri Pittier National Park, Rancho Grande , elevation 1200 m.
Etymology. The name is given for the country with the type locality and to rhyme with its related species, E. aequatorius . The name is treated as an adjective.
Distribution. Venezuela.
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
|
Kingdom |
|
|
Phylum |
|
|
Class |
|
|
Order |
|
|
Family |
|
|
SubFamily |
Eudaminae |
|
Tribe |
Entheini |
|
Genus |
