Telegonus ( Rhabdoides ) panavenus Grishin, 2025
|
publication ID |
https://doi.org/10.5281/zenodo.16642576 |
|
DOI |
https://doi.org/10.5281/zenodo.16806176 |
|
persistent identifier |
https://treatment.plazi.org/id/4D7E87DA-4B2D-725B-FEEF-FE4BADC1FD52 |
|
treatment provided by |
Felipe |
|
scientific name |
Telegonus ( Rhabdoides ) panavenus Grishin |
| status |
new species |
Telegonus ( Rhabdoides) panavenus Grishin , new species
http://zoobank.org/ FC50BC91-EE2B-40F6-886D-2322607EB90B ( Figs. 61 View Fig part, 63c–d, 65, 89 part)
Definition and diagnosis. Genomic analysis reveals that many specimens formerly identified as Telegonus hopfferi ( Plötz, 1881) (type locality in Mexico, likely south-central or southern, lectotype sequenced as NVG-22068G07) are either Telegonus gilberti (H. Freeman, 1969) (type locality in Mexico, San Luis Potosí, holotype sequenced as NVG-15104B08) or closer related to T. gilberti than to T. hopfferi in the Z chromosome and the mitochondrial genome trees ( Fig. 61b, c View Fig ). Among them, three specimens from Panama and Venezuela are in the Z chromosome clade that is sister to T. gilberti ( Fig. 61b View Fig ) and are genetically differentiated from it at the species level: with Fst / Gmin /COI barcode difference of 0.30/0.009/ 2.4% (16 bp). Therefore, they represent a new species. This species keys (incompletely) to “ Astraptes alector hopfferi ” C.14.26(a) in Evans (1952) but differs from it by having bluish rather than greenish overscaling at the wing bases and body above (similar to T. gilberti ), the forewing beneath lacking traces of apical pale spots, paler overscaling along the costal margin and the discal cell pale spot are absent or vestigial; the blue area along the costal margin of the dorsal forewing extending distad to approximately the same level as in the discal cell, but extending farther along the inner margin, the forewing in males being uniformly brown distad of the blue third, without a paler area in the middle; and the ampulla being wider separated from the dorsal process of the harpe ( Fig. 63d View Fig ). Due to the cryptic nature of this species, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly294.2.1:A591T, aly294.2.1:T1056C, aly294.2.1:A1086G, aly527.10. 9:A55G, aly527.10.9:C117T; and COI barcode: T40C, A43T, T124C, A166G, T424T, T571C.
Barcode sequence of the holotype. Sample NVG-14111B08, GenBank PV550012, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCAGGATTAATCGGTACTTCTTTAAGATTACTTATTCGAACTGAATTAGGAACTCCTGGATCTTTAATTGGTGACGATCAAATTTATAATACT ATCGTAACAGCTCATGCATTTATTATAATTTTTTTTATAGTTATGCCTATTATAATTGGAGGATTTGGAAATTGACTAGTTCCATTAATAATAGGAGCCCCTGATATAGCTTTCCCCCGTA TAAATAATATAAGATTTTGACTTTTACCCCCATCATTAACTTTATTAATTTCAAGAAGAATTGTAGAAAATGGTGCTGGAACAGGATGAACAGTTTATCCCCCTCTTTCATCTAATATTGC CCACCAAGGAGCATCAGTTGATTTAGCAATTTTTTCTTTACATTTAGCTGGTATTTCTTCTATTCTTGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAATAGATTATCT TTTGATCAAATACCTTTATTTGTTTGAGCTGTAGGAATTACAGCATTATTATTATTACTTTCTTTACCAGTTTTAGCAGGAGCTATCACTATATTATTAACTGATCGAAATCTAAATACCT CATTTTTTGACCCAGCTGGAGGAGGAGATCCAATTTTATATCAACATTTATTT
Type material. Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA ( USNM), illustrated in Fig. 65 View Fig , bears the following four printed (text in italics handwritten) rectangular labels, three white: [ PANAMA:PANAMA | 5 mi N El Llano | 330m 9°17'N 79°00'W | 18.VI.1978 | leg. G.B.Small], [GENITALIA NO. | X-56 22 | J.M.Burns 2003], [DNA sample ID: | NVG-14111B08 | c/o Nick V. Grishin], and one red [ HOLOTYPE ♂ | Telegonus (Rhabdoides) | panavenus Grishin]. GoogleMaps Paratypes: 2♂♂ in USNM: 1♂ NVG-14111B09 (leg DNA extraction, sequenced), NVG-23119E05 (abdomen DNA extraction and dissection) Panama, Veraguas Province, Ballena, 1-3-Feb-1979, G. B. Smal leg., genitalia NVG240817-44 ( Fig. 63c–d View Fig ) and GoogleMaps 1♂ NVG-14111B12 Venezuela, Nueva Esparta, Isla de Margarita , La Sierra , 500 m, GPS 11.0167, −63.8833, 13- 18-Mar-1988, R. K. Robbins leg. GoogleMaps
Type locality. Panama: Panamá Province, 5 mi north of El Llano GoogleMaps , elevation 330 m, approx. GPS 9.283, −79.000.
Etymology. The name is formed from the names of the counties with specimen records Pana [ma] + Ven [ezuela]+ us. The name is treated as a masculine noun in apposition.
Distribution. Currently know from central Panama and Isla de Margarita in Venezuela.
| USNM |
Smithsonian Institution, National Museum of Natural History |
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
|
Kingdom |
|
|
Phylum |
|
|
Class |
|
|
Order |
|
|
Family |
|
|
SubFamily |
Eudaminae |
|
Tribe |
Eudamini |
|
Genus |
