Telegonus ( Rhabdoides ) steinhauseri Grishin, 2025
|
publication ID |
https://doi.org/10.5281/zenodo.16642576 |
|
DOI |
https://doi.org/10.5281/zenodo.16804299 |
|
persistent identifier |
https://treatment.plazi.org/id/4D7E87DA-4B18-7261-FEF2-FA62AA0AFF35 |
|
treatment provided by |
Felipe |
|
scientific name |
Telegonus ( Rhabdoides ) steinhauseri Grishin |
| status |
new species |
Telegonus ( Rhabdoides) steinhauseri Grishin , new species
http://zoobank.org/ D916455A-197F-41FF-A0B5-1C2711054FDC ( Figs. 61 View Fig part, 74c–g, 77, 89 part)
Definition and diagnosis. This is the species Steinhauser (1987) identified as “ Astraptes weymeri .” However, the lectotype of Aethilla weymeri Plötz, 1882 (type locality not stated in the original description, likely in Panama: Chiriquí) reveals that it is a junior subjective synonym of Telegonus ( Rhabdoides) chiriquensis Staudinger, 1875 (type locality in Panama: Chiriquí), and this species is left without a name and is therefore new. In the nuclear genome trees, it is sister to T. perumazon sp. n. and is genetically differentiated from it at the species level ( Fig. 61 View Fig ); e.g., their COI barcodes differ by 3.8% (25 bp), and facies differ by reduced pale coloration by the ventral forewing tornus and more extensive yellow overscaling in the ventral hindwing submarginal area. This new species keys to “ Astraptes chiriquensis chiriquensis ” C.14.30a in Evans (1952) and was included by him in that taxon. However, it differs from T. chiriquensis by a larger greenish-blue area (bluer rather than greener) at the base of the dorsal forewing nearly reaching the discal dark band even near the costal margin; the yellow submarginal area of the ventral hindwing being stronger overscaled with brown (especially around the tornus and apex) or nearly all brown and only slightly paler than the rest of the wing; and the middle dark band on the ventral hindwing being shifted towards the discal band rather than the subapical band. Although this species may not be cryptic, in DNA, a combination of the following base pairs is diagnostic in the nuclear genome: aly250.4.1:C153T, aly250.4.1:A189C, aly971.19.1:T190C, aly971.19.1:T1341G, aly971.19.1:C2602T; and COI barcode: A34G, T49C, 508G, 596T.
Barcode sequence of the holotype. Sample NVG-23063E11, GenBank PV550023, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCAGGGTTAATTGGAACCTCCTTAAGATTACTTATTCGAACTGAATTAGGAACCCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATTGTAACAGCTCATGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGACTAGTCCCATTAATAATAGGAGCCCCTGATATAGCTTTTCCTCGTA TGAATAATATAAGATTTTGACTTTTACCCCCATCATTAACTTTATTAATTTCAAGAAGAATTGTTGAAAATGGTGCCGGAACAGGATGAACAGTTTATCCCCCTCTTTCATCTAATATTGC CCATCAAGGAGCATCAGTTGATCTAGCTATTTTCTCTTTACATTTAGCTGGTATTTCTTCTATTCTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAATAATTTATCT TTTGATCAAATACCTTTATTTGTGTGAGCTGTAGGAATTACAGCATTATTATTATTACTTTCATTACCAGTTTTAGCAGGAGCTATTACTATATTATTAACTGATCGAAATTTAAATACTT CATTTTTTGATCCAGCTGGAGGAGGAGATCCAATTTTATATCAACATTTATTT
Type material. Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity Collection, Gainesville, FL, USA ( MGCL), illustrated in Fig. 77 View Fig (genitalia Fig. 74c–g View Fig ), bears the following nine printed (text in italics handwritten) labels (2 nd triangular, others rectangular), seven white: [ MEXICO: VERACRUZ | Catemaco | X.19 72 | T. Escalante], [>, a piece of antenna is glued to this label, no text, [A. C. Allyn | Acc. 1973-48], [MGCL/FLMNH | Specimen no. | 16820], [Genit. Vials | SRS -1836], [ Telemachus weymeri | (Plötz, 1882) ♂ | Det. S.R. Steinhauser], [DNA sample ID: | NVG-23063E11 | c/o Nick V. Grishin], one pink without any text, and one red [HOLOTYPE ♂ | Telegonus (Rhabdoides) | steinhauseri Grishin] . Paratypes: 5♂♂ and 5♀♀: Mexico: Veracruz: 1♀ NVG-14082D02 Presidio , Jun-1942, T. Escalante leg. [ AMNH] and 1♀ NVG-18027G11 Santa Rosa, Aug-1906, Wm. Schaus collection [ USNM]; and Oaxaca, Candelaria Loxicha ,> 500 m, E. C. Welling leg.: 1♂ NVG-14082D03 7-Nov-1971 genitalia SRS-1702 [ AMNH]; 1♀ NVG-23063E07 2-Oct-1969 genitalia SRS-879 [ MGCL]; and 1♀ NVG-23063E08 4-Oct-1969 [ MGCL]; 1♂ NVG-23063E12 Guatemala, Santa Rosa , El Naranho , 25-Jun-1925, ex coll. E. Le Moult, genitalia SRS-864 [ MGCL]; 1♂ NVG-19075B01 Honduras, old. Edw. T. Owen collection, genitalia SRS-1838 [ USNM]; and Panama [ USNM]: Canal Zone, Farfan , S. S. Nicolay leg.: 1♂ NVG-14105A01, 14-Feb-1963 and 1♀ NVG-14105A02, 15-Feb-1963 and 1♂ NVG-19075B04, USNMENT 01588551 Herrera, Cerro Alto Higo , 1000 m, 23-Dec-1984, G. B. Small leg .
Type locality. Mexico: Veracruz, Catemaco .
Etymology. The name, a noun in the genitive case, honors Stephen R. Steinhauser, who made significant contributions to our knowledge of Hesperiidae and had a keen interest in Telegonus but did not have an opportunity to search for syntypes in Berlin and, therefore, did not recognize this species as new.
Distribution. From southern Mexico to Colombia and Venezuela.
Comment. We list data on all labels of the holotype, verbatim, including identification labels. One of such labels contains an unpublished name “ Telemachus .” Here, we use Art. 8.3. of the ICZN Code and disclaim the name “Telemachus” for nomenclatural purposes. Thus, we consider this name to be unpublished. Furthermore, we note that the unavailable infrasubspecific name Telegonus chiriquensis form godmani Williams, 1927 (see discussion of names by Williams in Zhang et al. (2022b)) refers to specimens most likely conspecific with this species.
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
|
Kingdom |
|
|
Phylum |
|
|
Class |
|
|
Order |
|
|
Family |
|
|
SubFamily |
Eudaminae |
|
Tribe |
Eudamini |
|
Genus |
