Telegonus (Rhabdoides) chiapus Grishin, 2025
|
publication ID |
https://doi.org/10.5281/zenodo.16642576 |
|
DOI |
https://doi.org/10.5281/zenodo.16804303 |
|
persistent identifier |
https://treatment.plazi.org/id/4D7E87DA-4B16-7262-FE14-FBB0AA43FACD |
|
treatment provided by |
Felipe |
|
scientific name |
Telegonus (Rhabdoides) chiapus Grishin |
| status |
new species |
Telegonus (Rhabdoides) chiapus Grishin , new species
http://zoobank.org/ 0A995D2A-A171-4311-A9E1-379669B6CC44 ( Figs. 61 View Fig part, 74h–o, 78, 89 part)
Definition and diagnosis. A male from Chiapas, Mexico (in MGCL collection) that resembles Telegonus chiriquensis Staudinger, 1875 ( type locality in Panama: Chiriquí) in wing patterns is genetically differentiated from it at the species level ( Fig. 61 View Fig ); e.g., their COI barcodes differ by 2.7% (18 bp) and, therefore, represents a new species. This new species keys to “ Astraptes chiriquensis chiriquensis ” C.14.30(a) in Evans (1952) but differs from its males by more extensive yellow coloration on the ventral side: the hindwing with a wider brownish-yellow marginal and tornal area, more weakly overscaled with the ground brown color and more extensively so only towards the apex, and prominent yellowish areas by the forewing tornus and inner margin and some overscaling in the postdiscal area; and more bluish, rather than greenish, overscaling on wing bases and body above, this overscaling is more restricted to the wing base, especially on the hindwing (but occupies nearly half of the hindwing in T. chiriquensis ). Due to unexplored individual variation in this species, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly619.2.3:T81C, aly619.2.3: C83T, aly619.2.3:A84G, aly276378.2.2:G167A, aly276378.2.2:T300C; and COI barcode: T385C, T442C, T472C, T499A, T568C, T622C.
Barcode sequence of the holotype. Sample NVG-23063G01, GenBank PV550024, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCAGGATTAATCGGAACTTCTTTAAGATTACTTATTCGAACTGAATTAGGAACTCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATTGTAACAGCTCACGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTCCCATTAATAATAGGAGCTCCTGATATAGCTTTTCCTCGTA TAAATAATATAAGATTTTGACTTTTACCCCCGTCATTAACTTTATTAATTTCAAGAAGAATTGTTGAAAATGGTGCTGGAACAGGATGAACAGTTTATCCCCCCCTTTCATCTAATATTGC CCACCAAGGAGCATCAGTTGACTTAGCTATTTTTTCTTTACATTTAGCTGGTATTTCTTCTATTCTTGGAGCTATTAACTTTATTACAACAATTATTAATATACGAATCAATAATTTATCT TTTGATCAAATACCATTATTTGTTTGAGCTGTAGGAATTACAGCATTATTATTATTACTTTCATTACCAGTTTTAGCAGGAGCCATTACTATATTATTAACTGATCGAAATTTAAATACTT CATTTTTTGATCCAGCCGGAGGAGGAGATCCAATTTTATATCAACATTTATTT
Type material. Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity Collection, Gainesville, FL, USA ( MGCL), illustrated in Fig. 78 View Fig (genitalia Fig. 74h–l View Fig ), bears the following eight printed (text in italics handwritten) rectangular labels (5 th pale-blue, last red, and others white): [ MEXICO: CHIAPAS | San Antonio | 4000'; sta. #4 | 8-VIII. 197 4 | R. Wind], [Genit. Prep. SRS- 856], [A. C. Allyn | Acc. 1974-24], [SRS Database | No. 673], [PARATYPE | Telemachus | draudti | S. R. Steinhauser], [MGCL/FLMNH | Specimen no. | 16922], [DNA sample ID: | NVG-23063G01 | c/o Nick V. Grishin], and [HOLOTYPE ♂ | Telegonus (Rhabdoides) | chiapus Grishin]. Paratypes: 2♂♂ from Mexico, Chiapas [ MGCL]: Selva Negra , 1700 m, Aug-1987, J. de la Maza E. leg.: 1♂ NVG-24064A04 and 1♂ NVG-24064A06 (leg DNA extraction, sequenced), NVG-24101A01 (abdomen DNA extraction and dissection), genitalia NVG241220 -23 ( Fig. 74m –o View Fig ) .
Type locality. Mexico: Chiapas, San Antonio , elevation 4000’.
Etymology. The name is formed from the name of the Mexican state with the type locality. The name is treated as a masculine noun in apposition.
Distribution. Currently known only from Chiapas, Mexico.
Comment. We list data on all labels of the holotype, verbatim, including identification labels. One of such labels contains an unpublished name “ Telemachus draudti ”, but according to our sequencing results, this specimen is not conspecific with the intended “ holotype ” of this name. To avoid further confusion, we use Art. 8.3. of the ICZN Code and disclaim the name “ Telemachus draudti ” for nomenclatural purposes. Thus, we consider this name to be unpublished.
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
|
Kingdom |
|
|
Phylum |
|
|
Class |
|
|
Order |
|
|
Family |
|
|
SubFamily |
Eudaminae |
|
Tribe |
Eudamini |
|
Genus |
