Tmarus fanjing Yang & Yu, 2022
|
publication ID |
https://dx.doi.org/10.3897/BDJ.11.e105352 |
|
persistent identifier |
https://treatment.plazi.org/id/42208F9D-B77B-5D32-BABA-3628DD1444C6 |
|
treatment provided by |
|
|
scientific name |
Tmarus fanjing Yang & Yu, 2022 |
| status |
|
Tmarus fanjing Yang & Yu, 2022 View in CoL
Materials
Type status: Holotype. Occurrence: recordedBy: Da Wang; Jaiyuan Xin; individualID: YHTHO001; individualCount: 1; sex: 1 male; lifeStage: 1 adult; behavior: foraging; preparations: whole animal (ETOH); associatedSequences: GenBank: ON392063 View Materials ; occurrenceID: 7FC42291-EC27-5A7D-9D64-6E9F98746510; Taxon: order: Araneae; family: Thomisidae ; genus: Tmarus ; specificEpithet: fanjing; taxonRank: species; scientificNameAuthorship: Yang & Yu; taxonomicStatus: accepted; Location : continent: Asia ; country: China; countryCode: CHN; stateProvince: Guizhou; county: Jiangkou ; locality: Fanjingshan Nature Reserve ; verbatimElevation: 755 m; decimalLatitude: 27.87; decimalLongitude: 108.80; Identification : identifiedBy: Jianshuang Zhang ; dateIdentified: 12-12-2022; identificationReferences: Yang et al. 2022; Event: samplingProtocol: Beating; samplingEffort: 10 km by foot; year: 2021; month: 4; day: 18; Record Level: basisOfRecord: PreservedSpecimen Type status: Other material. Occurrence: recordedBy: Haonan Zhang; individualCount: 2; sex: 1 male, 1 female; lifeStage: 2 adults; behavior: foraging; preparations: whole animal (ETOH); occurrenceID: A38DE598-7685-5DA5-AB10-C63D1031394B; Taxon: order: Araneae; family: Thomisidae; genus: Tmarus; specificEpithet: fanjing; taxonRank: species; scientificNameAuthorship: Yang & Yu; taxonomicStatus: accepted; Location: continent: Asia; country: China; countryCode: CHN; stateProvince: Guizhou; county: Jiangkou; locality: Fanjingshan Nature Reserve ; verbatimElevation: 1060 m; decimalLatitude: 27.90; decimalLongitude: 108.58; Identification: identifiedBy: Hao Yu; dateIdentified: 12-12-2022; identificationReferences: Yang et al. 2022; Event: samplingProtocol: Beating; samplingEffort: 10 km by foot; year: 2022; month: 7; day: 19; Record Level: basisOfRecord: PreservedSpecimen Type status: Other material. Occurrence: recordedBy: Cheng Wang; Xiaoqi Mi; individualID: YHTHO013, YHTHO014; individualCount: 4; sex: 2 males, 2 females; lifeStage: 4 adults; behavior: foraging; preparations: whole animal (ETOH); associatedSequences: ON796487 View Materials ; ON796486 View Materials ; occurrenceID: EE48AA39-2206-5DA9-8F4B-82BB2DA9B1D3; Taxon: order: Araneae; family: Thomisidae; genus: Tmarus; specificEpithet: fanjing; taxonRank: species; scientificNameAuthorship: Yang & Yu; taxonomicStatus: accepted; Location: continent: Asia; country: China; countryCode: CHN; stateProvince: Guizhou; county: Shiqian; locality: Fodingshan Nature Reserve ; verbatimElevation: 858 m; decimalLatitude: 27.36; decimalLongitude: 108.0; Identification: identifiedBy: Cheng Wang; dateIdentified: 12-05-2022; identificationReferences: Yang et al. 2022; Event: samplingProtocol: Beating; samplingEffort: 10 km by foot; year: 2017; month: 4; day: 28; Record Level: basisOfRecord: PreservedSpecimen GoogleMaps GoogleMaps GoogleMaps GoogleMaps GoogleMaps GoogleMaps
Description
Female (Figs. 1A-C and 2A). Overall body colour is dull brown in ethanol. Total length 6.34; carapace 2.33 long, 2.25 wide; abdomen 4.01 long, 2.23 wide.
Carapace (Fig. 1 View Figure 1 A, C and Fig. 2 View Figure 2 A) dull brown mottled with light yellow and white patches, oval marking, light yellow outlines; ocular area slightly lighter; cervical groove and radial grooves distinguishable. In dorsal view, both anterior eye row (AER) and posterior eye row (PER) slightly recurved, PER distinctly wider than AER. Eye sizes and interdistances: anterior median eyes (AME) 0.08, anterior lateral eyes (ALE) 0.16, posterior median eyes (PME) 0.09, posterior lateral eyes (PLE) 0.14; distance between AMEs (AME-AME) 0.25, distance between AME and ALE (AME-ALE) 0.22, distance between PMEs (PME-PME) 0.34, distance between PME and PLE (PME-PLE) 0.49. Length of median ocular quadrangle (MOQ) 0.50, MOQ anterior width 0.39, MOQ posterior width 0.52. Clypeal height 0.42. Chelicerae coloured as ocular area, both margins without teeth. Labium and endites uniformly light brown, endites depressed posteriorly, slightly convergent anteriorly, with dense scopulae on anterior margin; labium nearly diamond-shaped, anterior margin with sparse setae. Sternum yellowish-white, more or less cordiform or shield-shaped, 1.20 long, 0.93 wide.
Abdomen (Fig. 1 View Figure 1 A-C) elongate, pyriform or shaped like a shield in dorsal view, tapering posteriorly, posteriorly with a prominent caudo-dorsal hump. Dorsum basically grey or light brown, with many long spiniform setae and greyish spots; venter yellowish-white, without distinct pattern; spinnerets brown.
Legs uniformly yellowish-white (Fig. 1 View Figure 1 A and B). Leg length: I 9.36 (2.88, 3.52, 1.95, 1.01), II 9.40 (2.85, 3.52, 2.00, 1.03), III 5.29 (1.75, 2.06, 0.87, 0.61), IV 5.57 (1.97, 2.03, 0.93, 0.64).
Epigyne (Fig. 2 View Figure 2 C-F). Epigynal plate slightly longer than wide, anterior and lateral margin not delimited, posterior margin rebordered; spermathecae (SP) clearly visible through the tegument in ventral view. Epigynal plate with an atrium (A) and a hood (H). Atrium large, represented by a deep depression, more than 2/3 epigyne width, anterior margin not rebordered, posterior margin delimited by the heavily sclerotised hood. Hood more or less ˽-shaped, nearly as wide as epigyne. Copulatory openings (CO) indistinct, at basolateral atrial borders, leading to copulatory ducts (CD) which descend obliquely to connect with spermathecae (SP). Spermathecae reniform, about 1.73 longer than wide, the two spermathecae separated by about one diameter. Fertilisation ducts (FD) acicular, membranous, located terminally on spermathecae.
Male (Fig. 1 View Figure 1 D-F and Fig. 2 View Figure 2 B). Total length 4.09; carapace 1.81 long, 1.75 wide; abdomen 2.28 long, 1.28 wide. Eye sizes and interdistances: AME 0.07, ALE 0.14, PME 0.09, PLE 0.12; AME-AME 0.13, AME-ALE 0.17, PME-PME 0.25, PME-PLE 0.32. MOQL 0.50, MOQA 0.30, MOQP 0.42. Sternum 0.93 long, 0.82 wide. Measurements of legs: I 11.1 (3.15, 4.00, 2.67, 1.28), II 10.95 (3.13, 3.94, 2.66, 1.22), III 5.24 (1.64, 2.02, 0.92, 0.66), IV 4.78 (1.76, 1.47, 0.95, 0.60). General characters as in female, but slightly smaller in size and lighter in colour.
Palp (Fig. 3 View Figure 3 A-D). Tibia relatively short, about 1/3 of cymbium length, with two apophyses: ventral apophysis (VTA) relatively short, nearly as long as tibia, apex blunt and curved, forming a semicircle in ventrally view; retrolateral apophysis (RTA) relatively long, ca. 1/2 of cymbium length, thumb-like in retrolateral view, apex rostrate and pointing ventrally. Tegulum (T) circular and relatively flat; sperm duct distinct, forming a loop along tegular margin. Embolus (E) thick and heavily sclerotised, finger-shaped; embolar base (EB) wide, partly membranous, inserted about 1~3 o’clock position of tegulum; embolar tip (ET), terminated at approximately 9 o’clock position relative to tegulum, apex slightly curved and blunt.
DNAbarcodes
5'TATTTGGAGCGTGATCGGCTATAGTAGGAACTGCTATAAGAGTATTGATTCGAATAGAATTAGGTAATTCAGGAAGACTTTTTGGAAATGATCATTTATATAATGTAATTGTGACTGCTCATGCTTTTGTGATAATTTTTTTTATAGTTATACCTATTTTAATTGGAGGATTTGGTAATTGATTAGTACCTTTGATATTAGGGGCTCCTGATATATCTTTTCCTCGAATAAATAATTTATCTTTTTGGTTATTACCTCCTTCTTTATTTTTATTATTTATATCTTCTATAGTAGAAATAGGAGTAGGAGCTGGATGAACTGTATATCCACCTTTGGCTTCTAGTTTAGGTCATATAGGGAGATCAATGGATTTTGCTATTTTTTCTCTTCATTTAGCTGGGGCTTCTTCAATTATAGGGGCTGTAAATTTTATTTCTACTATTATTAATATACGAAGAGTAGGAATGACTATAGAAAAGGTGCCTTTATTTGTCTGATCGGTGTTAATTACTGCTATTTTACTTTTATTATCATTACCTGTTTTAGCAGGAGCTATTACTATATTATTAACAGATCGAAATTTTAATACTTCGTTTTTTGACCCTGCTGGTGGAGGGGATCCAATTTTATTTCAACATTTATTTTGATTTTT3' (YHTHO013; Genebank accession number: ON796487).
5'TATTTGGAGCGTGATCGGCTATAGTAGGAACTGCTATAAGAGTATTGATTCGAATAGAATTAGGTAATTCAGGAAGACTTTTTGGAAATGATCATTTATATAATGTAATTGTGACTGCTCATGCTTTTGTGATAATTTTTTTTATAGTTATACCTATTTTAATTGGAGGATTTGGTAATTGATTAGTACCTTTGATATTAGGGGCTCCTGATATATCTTTTCCTCGAATAAATAATTTATCTTTTTGGTTATTACCTCCTTCTTTATTTTTATTATTTATATCTTCTATAGTAGAAATAGGAGTAGGAGCTGGATGAACTGTATATCCACCTTTGGCTTCTAGTTTAGGTCATATAGGGAGATCAATGGATTTTGCTATTTTTTCTCTTCATTTAGCTGGGGCTTCTTCAATTATAGGGGCTGTAAATTTTATTTCTACTATTATTAATATACGAAGAGTAGGAATGACTATAGAAAAGGTGCCTTTATTTGTCTGATCGGTGTTAATTACTGCTATTTTACTTTTATTATCATTACCTGTTTTAGCAGGAGCTATTACTATATTATTAACAGATCGAAATTTTAATACTTCGTTTTTTGACCCTGCTGGTGGAGGGGATCCAATTTTATTTCAACATTTATTTTGATTTTT3' (THO014; Genebank accession number: ON796486).
Diagnosis
Both sexes of T. fanjing are similar to those of T. piger (Walckenaer, 1802) (type species of Tmarus , see Ono (1977): 68, figs 1-6, 19, 28-31; Song and Zhu (1997): 51, fig. 28A-D) for the general shape of male palp and female vulva. T. fanjing and T. piger share the similar thick embolus directed obliquely and the large atrium (usually absent in many other Tmarus species). However, T. fanjing can be distinguished from T. piger by the following characters: for the males, embolus apex blunt in T. fanjing (vs. relatively sharp; Ono (1977): 68, figs 5, 6; Song and Zhu (1997): 51, fig. 28C); VTA apex curved, forming a semicircle in ventrally view (vs. not curved; Ono (1977): 68, figs 5, 6; Song and Zhu (1997): 51, fig. 28C); RTA nearly erect (vs. nearly horizontally directed; Ono (1977): 68, figs 5, 6; Song and Zhu (1997): 51, fig. 28C, D); for the females, epigyne ventrally with a hood in T. fanjing (vs. hood absent; Ono (1977): 68, fig. 3; Song and Zhu (1997): 51, fig. 28A).
Distribution
Known from the Mt. Fanjing and Mt. Foding, Guizhou Province, China (Fig. 7 View Figure 7 )
Taxon discussion
The species Tmarus fanjing Yang & Yu, 2022 was first described, based on male specimens only from Mt. Fanjing of Guizhou Province, China. Detailed description, diagnosis, high quality photographs and DNA barcoding of the holotype are provided in the original paper (see Yang et al. (2022)), to allow for easy species recognition. Recently, new materials containing both sexes were collected from the type locality and near the type locality (Mt. Foding, Guizhou Province, China; Fig. 7 View Figure 7 ) simultaneously and seemed to be this species, based on comparison with the type specimen. DNA barcodes (a partial fragment of the mitochondrial cytochrome oxidase subunit I gene, COI) of the new materials was also obtained to confirm gender matching and species identification.
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
|
Kingdom |
|
|
Phylum |
|
|
Class |
|
|
Order |
|
|
Family |
|
|
Genus |
