Telegonus ( Rhabdoides ) flavifimbro Grishin, 2025
|
publication ID |
https://doi.org/10.5281/zenodo.16570612 |
|
publication LSID |
lsid:zoobank.org:pub:504B8C6D-D4AA-4489-8CE4-A636BC5F5426 |
|
DOI |
https://doi.org/10.5281/zenodo.16570646 |
|
persistent identifier |
https://treatment.plazi.org/id/42116960-6039-B336-FECA-226A5B75BC4D |
|
treatment provided by |
Felipe |
|
scientific name |
Telegonus ( Rhabdoides ) flavifimbro Grishin |
| status |
sp. nov. |
Telegonus ( Rhabdoides) flavifimbro Grishin , new species
http://zoobank.org/ 16CBDDCE-329A-402A-9C25-25D6790F53EC ( Figs. 8 View Fig part, 9b–c)
Definition and diagnosis. Genomic analysis reveals that two females from Colombia, initially identified as Telegonus ( Rhabdoides) chiriquensis Staudinger, 1875 (type locality in Panama: Chiriquí) are genetically differentiated from it at the species level ( Fig. 8 View Fig ); e.g., their COI barcodes differ by 4.1% (27 bp). Instead, these females form a nuclear genome clade sister to Telegonus ( Rhabdoides) flavimargo Grishin, 2025 (type locality in Costa Rica), also differing from it at the species level, e.g., COI barcodes of the holotypes differ by 4.0% (26 bp), and, therefore, they represent a new species. This new species keys to “ Astraptes chiriquensis chiriquensis ” C.14.30(a) in Evans (1952), but differs from it and other relatives by the following combination of characters in females: an iridescent area at the base of the dorsal forewing is similar to or more developed than in T. chiriquensis but less extensive and greener than in T. flavimargo ; the tornal area of the ventral forewing is even darker than in T. flavimargo ; a yellow submarginal region on the ventral hindwing is the broadest close to the middle of the wing and narrowing towards the tornus, slightly broader than in T. flavimargo ; a dark postdiscal band on the ventral forewing that is equidistant from the apical and discal bands (not closer to the apical band); more strongly expressed dark bands on the dorsal forewing; and more saturated in color and brighter orange-yellow fringes on the hindwing. Due to its cryptic nature and unexplored individual variation, this species is best C52T, aly275209.7.3:G198A, aly3614.1.6:C40T, aly393.1.23:C57G. In the COI barcode, this new species may not differ from others due to mitochondrial introgression among its relatives.
Barcode sequence of the holotype. Sample NVG-24028C10, GenBank PV892286, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCAGGATTAATCGGAACTTCTTTAAGATTACTTATTCGAACTGAATTAGGAACCCCAGGATCTTTAATTGGAGACGATCAAATTTATAACACT ATTGTAACAGCTCATGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTCCCATTAATAATAGGAGCTCCTGATATAGCTTTTCCTCGTA TAAATAATATAAGATTTTGACTTCTACCCCCATCATTAACTTTATTAATTTCAAGAAGAATTGTTGAAAATGGTGCTGGAACAGGATGAACAGTTTATCCCCCTCTTTCATCTAATATTGC CCACCAAGGAGCATCAGTTGATTTAGCTATTTTTTCCCTACATTTAGCTGGTATTTCTTCTATTTTAGGAGCTATTAATTTTATTACAACAATTATTAACATAAAAATTAATAATTTATCT TTTGATCAAATACCTTTATTTGTATGAGCTGTTGGAATTACAGCATTATTATTATTACTTTCATTACCAGTTTTAGCAGGAGCTATTACTATATTATTAACTGATCGAAATTTAAATACTT CATTTTTTGATCCAGCAGGAGGAGGAGACCCAATTTTATACCAACATTTATTT
Type material. Holotype: ♀ deposited in the Museum für Naturkunde, Berlin, Germany ( MFNB), illustrated in Fig. 9b View Fig , bears the following seven rectangular labels (first four handwritten, others printed), six white: [Columbia | 86 Klbr.], [201.], [ T. chiriquensis | ♀ var.], [chiriquensis | var.], [{QR Code} MfN URI | http://coll.mfn- | berlin.de/u/ | 09ec52], [DNA sample ID: | NVG-24028C10 | c/o Nick V. Grishin], and one red [HOLOTYPE ♀ | Telegonus (Rhabdoides) | flavifimbro Grishin ] . Paratype: 1♀: NVG-24039F01 Colombia, Boyacá, Muzo , Mar-1918, W. Gerstner leg. [ SMNS] ( Fig. 9c View Fig ) .
Type locality. Colombia, possibly in the eastern Andes .
Etymology. Formed similarly to flavimargo , the name is given for the orange-yellow fringes ( fimbia in Latin), particularly noticeable in the holotype of this species. The name is also longer to indicate a more southern distribution of this species and is treated as a noun in apposition.
Distribution. Currently known only from Colombia.
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
|
Kingdom |
|
|
Phylum |
|
|
Class |
|
|
Order |
|
|
Family |
|
|
Genus |
