Ochlodes ( Ochluma ) sylvanoides paranapa Grishin, 2025

Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina & Grishin, Nick V., 2025, Update to: Advancing butterfly systematics through genomic analysis, The Taxonomic Report of the International Lepidoptera Survey 12 (6), pp. 1-36 : 29-30

Ochlodes ( Ochluma) sylvanoides paranapa Grishin , new subspecies

http://zoobank.org/ ADC1FE05-7B71-4C9D-B788-64E7A2F82FE2 ( Figs. 19 part, 20 part, 21b–d)

Definition and diagnosis. Genomic analysis reveals that populations from the northeastern part of the range, historically identified as Ochlodes napa (W. H. Edwards, 1865) ( type locality in USA: Colorado, Clear Creek Co. ), are not in the same clade with this species but instead belong to Ochlodes ( Ochluma) sylvanoides (Boisduval, 1852) ( type locality in USA: California, Plumas Co.), being genetically differentiated from others at the subspecies level ( Fig. 20a magenta and violet). While their COI barcodes (or mitogenomes, Fig. 20b ) do not consistently differ, these populations together form a distinct moderately supported (88% bootstrap value) clade in the nuclear genome tree ( Fig. 20a ) that partitions into two more strongly supported subclades: northeastern ( Fig. 20a violet, 93% bootstrap) and southwestern ( Fig. 20a magenta, 100% bootstrap). The southwestern clade is most strongly differentiated genetically (longer branch) and supported statistically (100%) encompassing specimens from a wide geographical area spanning three states ( Montana, Wyoming, and South Dakota) ( Fig. 19 magenta). In addition to differences in DNA, these specimens are characterized by phenotypic differences from the nominate subspecies (due to which they were misidentified as O. napa ), and, therefore, represent a new subspecies of O. sylvanoides . This new subspecies keys to “ Ochlodes sylvanoides napa ” (M.19.2(c)) in Evans (1955), but differs from it and other relatives by the following combination of characters: paler below, with a weaker pattern ( Fig. 21b–d ) than typical for the nominate subspecies ( Fig. 21a ), i.e., brown borders above are narrower, paler, and more diffuse at the edges; the ventral side is yellower (instead of redder) and usually with a more weakly defined brownish or reddish pattern, but typically more prominent than in O. napa ( Fig. 21g –j ) postdiscal pale bands on both wings; dorsally slightly darker than O. napa , with a stronger contrast between brown and orange areas and broader dorsal hindwing brown margins with more strongly developed brown overscaling over the orange areas between inverted brown triangles. Due to extensive individual variation in wing patterns, this subspecies is best identified by DNA, with diagnostic base pairs in the nuclear genome: aly275184.2.3:C501T, aly275184.2.3:C885T, aly 2085.1.10: A675G, aly 2085.1.10:C678T, aly 1846.1.1:C185A; and the COI barcode does not distinguish this subspecies from others.

Barcode sequence of the holotype. Sample NVG-24126C06, GenBank PV892290, 658 base pairs: AACTTTATACTTTATTTTTGGTATTTGAGCAGGAATATTAGGAACTTCTTTAAGTTTATTAATTCGTACAGAATTAGGTAATCCAGGATCTTTAATTGGCGATGACCAAATTTATAATACT ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTTCCATTAATATTAGGAGCTCCTGATATAGCATTTCCTCGAA TAAATAATATAAGATTTTGAATATTACCTCCTTCATTAACATTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACTGGTTGAACAGTATATCCTCCTTTATCTTCTAATATTGC TCACCAAGGATCTTCTGTTGATTTAGCAATTTTTTCTCTTCATTTAGCTGGTATTTCATCTATTCTAGGAGCTATTAATTTTATTACAACAATTATCAATATACGAATTAAAAACTTATCA TTTGATCAAATACCCTTATTTGTATGATCAGTAGGTATTACAGCATTATTATTATTATTATCTTTACCTGTATTAGCAGGTGCTATTACAATATTACTTACTGATCGAAATTTAAATACTT CTTTTTTTGATCCAGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT

Type material. Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity Collection, Gainesville, FL, USA ( MGCL), illustrated in Fig. 21b , bears the following five printed (handwritten text in italics) rectangular labels, four white: [WY WASHAKIE Co. | T47N R86W S5 | Tensleep Reserve | 6400' 11-12.viii.98], [Allyn Museum | Acc. 1998-15], [ Ochlodes sylvanoides | (Boisduval, 1852) ♂ | Det. S.R. Steinhauser], [DNA sample ID: | NVG-24126C06 | c/o Nick V. Grishin], and one red [HOLOTYPE ♂ | Ochlodes sylvanoides | paranapa Grishin]. Paratypes: 4♂♂ and 1♀ from USA in MGCL: Montana, Big Horn Co .: 1♂ NVG-24126B10 foothills of Pryor Mts ., along Sage Creek , 5550’, 45.227 2, −108.585 6, 13-Aug-1997, Chuck & Chris Harp leg. ( Fig. 21c ) and 1♀ NVG-24126B12 25 mi SW of Lodge Grass, 6-Sep-1971, Jack Harry leg. ; 1♂ NVG-24126C01 Wyoming, Big Horn Co., Red Grade Spring , 5000’, 13-Aug-1954; and South Dakota : 1♂ NVG-24127A08 Butte Co., USH212 at mi 17, ca. 2 mi E of Belle Fourche, 3-Aug-1983, D. L. Eiler leg. ( Fig. 21d ) and 1♂ NVG-24127A07 Lawrence Co., no locality details, 27-Aug-1969, M. L. May .

Type locality. USA: Wyoming, Washakie Co., Bighorn Mountains, Tensleep Preserve , elevation 6400 ft.

Etymology. The name reflects a superficial resemblance between O. napa and this new subspecies of O. sylvanoides , as it parallels O. napa but occurs at more northern latitudes. The name is treated as a noun in apposition.

Distribution. Currently known from east of the main Rocky Mountain chain in Montana and Wyoming, and from South Dakota.

Figures

Fig. 19. A map of sequenced specimens from the Ochlodes sylvanoides group. Species are shown as symbols of different shapes and subspecies are denoted by color: O. santacruza (stars), O. sylvanoides (squares), and O. napa (circles); O. santacruza santacruza (red), O. santacruza catalina (orange), O. sylvanoides sylvanoides including orecoasta, bonnevilla, and omnigena (green), O. sylvanoides dempwolfi ssp. n. (violet), O. sylvanoides paranapa ssp. n. (magenta), O. napa kaibab (blue), and O. napa napa (yellow). The type localities are marked with tiny white circles inside symbols, and names of corresponding subspecies are placed nearby.

Fig. 20 (see the previous two pages). Phylogenetic trees of the Ochlodes sylvanoides group species constructed from proteincoding regions in: a) the nuclear genome (autosomes), based on 312,678 positions, and b) the mitochondrial genome. Different

Fig. 21. Selected specimens of Ochlodes (Ochluma) sylvanoides group from USA in dorsal (left) and ventral (right) views, data in text or below [MGCL unless indicated]: a) O. sylvanoides sylvanoides ♂ NVG-24126B08 MT, Missoula Co., Nine Mile Creek, 8-Aug-1988, S. Kohler leg.; b–d) O. sylvanoides paranapa ssp. n.: b) holotype ♂ NVG-24126C06 WY, Washakie Co. and paratypes: c) ♂ NVG-24126B10 MT, Big Horn Co. and d) ♂ NVG-24127A08 SD, Butte Co.; e–f) O. sylvanoides dempwolfi ssp. n. from ND, Slope Co.: e) holotype ♂ NVG-23032D05 and f) paratype ♀ NVG-23032D03 [WRD]; g–h) O. napa kaibab from WY: g) ♂ NVG-24126C02 Park Co., Front, Dead Indian Hill, 6400’, 3-Aug-2000, E. H. Williams leg. and h) ♀ NVG-24126C07 Teton Co., Yellowstone National Park, Mammoth Hot Springs, 16-Aug-1972, D. L. Lindsley leg.; i–j) O. napa napa: i) ♂ NVG-24126C04 WY, Carbon Co., Saratoga, 3-Aug-1981, D. L. Eiler leg. and j) ♀ NVG-24127A05 CO, El Paso Co., Garden of Gods, 12-18-Jul-1986, J. Hyatt leg.