Macgrathphora longifurca, Brown, 2022
publication ID |
https://doi.org/10.11646/zootaxa.5115.4.7 |
publication LSID |
lsid:zoobank.org:pub:23F98AA6-D461-4249-A264-289FA0D22608 |
persistent identifier |
https://treatment.plazi.org/id/2F7B879A-FFCC-FF92-FF21-F8E8FCA9F885 |
treatment provided by |
Plazi (2022-03-16 08:49:52, last updated by Diego 2022-03-31 12:32:06) |
scientific name |
Macgrathphora longifurca |
status |
new species |
Macgrathphora longifurca new species
( Figs 2 View FIGURES 1–4 , 7, 8 View FIGURES 5–10 , 12 View FIGURES 11–14 )
HOLOTYPE. ♂, slide mounted. PANAMA: Barro Colorado Island , Drayton Tr., 9.15°N, 79.85°W, 31.v.2014, H. Barrios and Y. Basset, Malaise trap ( GMPAB675-18 ) ( MIUP). GoogleMaps
PARATYPES. ECUADOR: Manabi: Cerro Pata de Pajaro , 0°N, 75.95°W, 300m, 1♂, 19–21.vi.1996, P.Hibbs, Malaise trap ( LACM) GoogleMaps . PANAMA: same locality as holotype, 1♂, 7–14.x.1992, Malaise trap, J. Pickering 995, 1♂, same data as holotype ( LACM) GoogleMaps . COSTA RICA: Limón: Pandora, Estrella Valley , 9.73°N, 82.97°W, 1♂, 29.iii.1984, G. V. Manley, Malaise trap ( LACM) GoogleMaps . Puntarenas: 3km SW Rincon , 8.68°N, 83.48°W, 10m, 1♂, vii–ix.1990, P.Hanson, Malaise trap ( LACM) GoogleMaps . San José: Zurquí de Moravia , 10.05°N, 84.01°W, 1♂, ix–x.1990, P.Hanson, Malaise trap ( LACM) GoogleMaps , 1♂, 22.x–12.xi.2012, Malaise trap #1, ZADBI-186, 2♂, 2♀, 4–11.x.2013, Malaise trap #1, ZADBI-1242 ( LACM, MUCR) .
Diagnosis. The wing venation differs from that of M. carribea in that the swelling of Rs is less pronounced, the radial fork, especially R 2+3, is longer, and M 1 appears to arise more distally than the base of the R-fork ( Figs. 7–8 View FIGURES 5–10 ).
In BOLD, this species is in BIN BOLD:ACG3720. The nearest neighbor in BOLD, based on the CO1 DNA barcode, is BOLD:AED5813, a BIN for a species from Africa in the study of Srivathsan et al. (2019) for which no specimens are photographed. Emily Hartop kindly sent me a photograph of this species, however, and it is a Megaselia that looks completely unlike Macgrathphora .
The cluster width for the 55 sequences of this BIN in BOLD is 0.92%, and thus below the threshold established by Hartop et al. (2021) for concern about containing multiple species. I have not examined specimens from the entire range of haplotypes, however. The barcodes for this BIN differ from those of the previous species (BOLD: ACS8553) by about 11–13%.
Holotype barcode:
TTATACTTTATTTTTGGGGCTTGAGCAGGAATAGTAGGAACATCATTAAGAATCATAATTCGAGCTGAA TTAGGTCATCCCGGTGCTTTAATTGGAGATGATCAAATTTATAATGTAATTGTAACTGCCCATGCTTTTA TTATAATTTTTTTTATAGTAATACCTATTATAATAGGAGGATTTGGAAATTGACTAGTCCCTTTAATATTAG GTGCTCCAGATATAGCCTTTCCTCGAATAAATAATATAAGATTTTGATTATTACCTCCTTCTCTTACCTTA CTATTAGCCAGAAGCATAGTAGAAAATGGAGCTGGTACAGGATGAACCGTTTACCCTCCACTTTCTTC AAATATTGCTCATAGTGGAGCATCAGTTGATTTAGCAATTTTTTCTCTTCACTTAGCAGGAATTTCATCT ATTTTAGGAGCAGTAAATTTTATTACTACTATTATTAATATACGATCTTCAGGTATTACTTTTGACCGTAT ACCTTTATTTGTATGATCAGTAGGTATCACTGCAATTTTATTACTACTTTCTTTACCTGTTTTAGCAGGA GCAATTACAATATTATTAACTGATCGAAATTTTAATACTTCATTTTTTGACCCTGCTGGAGGTGGAGATC CTATTTTATACCAACATTTATT--------------------------------------------------------------------.
Distribution. This species is known from both lowland and middle elevations sites in Central and South America. The BOLD database has records for both lowland dry forest (Pacific slope) and lowland tropical forest (Caribbean slope) in the ACG. From what can be seen in the photographs on the BOLD web site, they are all conspecific with the holotype and paratype from Panama, and thus congruent with the BIN.
Etymology. The species name refers to the elongate R-fork.
Hartop, E. A., Srivathsan, A., Ronquist, F. & Meier, R. (2021) Large-scale integrative taxonomy (LIT): resolving the data conundrum for dark taxa. bioRxiv. [preprint, https: // www. biorxiv. org / content / 10.1101 / 2021.04.13.439467 v 1] https: // doi. org / 10.1101 / 2021.04.13.439467
Srivathsan, A., Hartop, E. A., Puniamoorthy, J., Lee, W. T., Kutty, S. N., Kurina, O. & Meier, R. (2019) Rapid, large-scale species discovery in hyperdiverse taxa using 1 D MinION sequencing. BMC Biology, 17, 96. https: // doi. org / 10.1186 / s 12915 - 019 - 0706 - 9
FIGURES 1–4. Habitus, male, lateral. 1. Macgrathphora caribbea new species. 2. Macgrathphora longifurca new species. 3. Macgrathphora pacifica new species. 4. Aurisetiphora maggiesnowae new species.
FIGURES 5–10. Wing male. 5–6. Macgrathphora caribbea new species. 5. Male. 6. Female. 7–8. Macgrathphora longifurca new species. 7. Male. 8. Female. 9. Macgrathphora pacifica new species, male. 10. Aurisetiphora maggiesnowae new species, male.
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.